Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13756

FASTA Sequence
Unigene ID: UN13756Length: 3197  SNP
GCGTACACGTGAACTGTTACTACTTTCTTGGAGTCAGAGCCTTATCAATAGTATTCAATATGACCAAATTAAATGATTATTTTATT
TAACTTTGAGATATTGATCTTGTTTTTTTTTTGGTTTGATGCAGTTAAAAAAAAACAAAAATGGCGTCTCACATTGTTGGATATCC
TCGTATGGGCCCCAAGAGAGAACTCAAGTTCGCGTTGGAGTCATTCTGGGATAAGAAGACCACTGCTGAGGATCTTCAGAAGGTGT
CTGCTGATATCAGGTCTGGTATCTGGAAGCAGATGTCTGAGGCTGGGACTAAGTACATCCCGAGCAACACCTTTGCTCACTACGAT
CAGGTTCTCGACACCACCGCTATGCTCGGTGCTGTTCCACCCAGATACGGTTACACCGGTGGTGAGATCGGGTTGGATGTTTACTT
CTCCATGGCCAGAGGAAATGCCTCTGTTCCCGCCATGGAAATGACCAAGTGGTTTGACACCAACTAGTGAGTCTTGAACCCTCTGA
ACTGTGCCTTGCAGCGACATTGTTAGGTGGATTTAAGAAAAAAAACTTTTTGACTAATGTAATGATGTTTTATTGATGCAGCCACT
ACATCGTCCCTGAGTTGGGCCCTGAGGTTAACTTTTCCTACGCTTCTCACAAGGCTGTGAATGAGTACAAGGAGGCCAAAGCTGTA
CGTATCATTCTTCATTTATTATGAAATTACTAGATTTACTATACTCTTAATTGATTGGAATAAAATAATAGGCTGTGGTTCTAGGA
TTTAGCGTTTGTGCTTAGATTCATTGATTGGTGTTTCATTGAGGATACTAATGTTTTTAGAATTCACAAACCACACTTGCTTGATA
GAATTGCTGGAAGAAATTAATTTGACTGTGGTTGTCTTTTGTACACCTAGAGTAGTTTCTTGTTCTTCTGCTACTTCTCTTTTGTT
CACTTGAATATGTTTCGTTTTCATCTGCTAGACTGCTATTTTAAAGTTCTGACTTTATAACTTGATGTTTATGCAGCTTGGTGTTG
ACACCGTCCCCGTACTTGTTGGCCCTGTCTCTTACTTGTTGCTTTCCAAGGCTGCCAAGGGTGTAGAGAAGTCATTTGATCTTCTT
TCTCTTCTCCCCAAAGTTCTCGCTGTCTACAAGTAAGAAATCAATTCTCTTTATCTTTCGCTTCAGTTATGAATGATCCTCTGACA
TGCCACTGAATATTGTGACTTTGATTTGTGTACAGGGAAGTGATCACCGAGCTTAAGGCAGCTGGTGCCACCTGGATTCAGCTTGA
CGAGCCTGTCCTTGTCATGGATCTTGAGGGCCACAAACTCCAGGCCTTTACTGGAGCCTATGCTGAACTTGAATCAACTCTATCTG
GCTTGAATGTTCTAGTGGAGACCTACTTCGCTGATATCCCTGCTGAAGCATACAAGACCCTTACTTCCTTGAAGGGTGTGACTGCC
TATGGATTTGATTTGGTTCGTGGCACAAAGACTCTTGATTTGGTCAAGGCCGGTTTCCCTGAGGGAAAGTACCTCTTCGCTGGTGT
TGTTGATGGAAGGAACATCTGGGCCAATGACTTTGCTGCGTCTCTTAGCACCTTGGAAGCACTTGAGGGTGTTGTTGGAAAGGATA
AGCTTGTGGTCTCAACCTCCTGCTCTCTTCTCCACACCGCTGTTGATCTTATCAACGAGACTAAGCTTGACGATGAAATCAAGTCA
TGGATGGCCTTTGCTGCCCAGAAGGTCGTTGAAGTGAACGCATTGGCTAAGGCTTTGGCTGGTCACAAGGATGAGGCTCTTTTCTC
TGCCAACGCTGCTGCTTTGGCTTCAAGGAGATCTTCCCCAAGAGTCACCAACGAGGGTGTGCAGAAGGCTGCTGCTGCTTTGAAGG
GCTCTGACCACCGTCGTGCAACCAATGTTAGTGCTAGACTAGATGCTCAGCAGAAGAAGCTCAACCTCCCAATCCTTCCAACCACC
ACCATTGGGTCCTTCCCACAGACCGTAGAGCTCAGGAGAGTTCGCAGAGAGTACAAGGCAAAGAAGGTGTCTGAGGAGGACTACGT
TAAGGCCATGAAGGAAGAGATCAAGAAAGTTGTTGACCTCCAAGAGGAACTTGACATCGATGTTCTTGTCCACGGAGAGCCAGAGA
GAAACGACATGGTTGAGTACTTTGGTGAGCAGTTGTCTGGTTTTGCCTTCACTGCCAATGGATGGGTCCAATCTTATGGATCTCGC
TGTGTGAAGCCACCAGTTATCTACGGTGATGTGAGCCGTCCCAAGGCAATGACTGTCTTCTGGTCCGCAATGGCTCAGAGCATGAC
CTCTCGCCCAATGAAGGGTATGCTTACCGGCCCTGTCACCATTCTCAACTGGTCCTTTGTCAGGAACGACCAGCCCAGGCACGAAA
CCTGTTACCAGATTGCTTTGGCCATCAAGGACGAAGTCGAGGACCTTGAGAAGGGTGGAATCGGTGTCATTCAGATCGACGAGGCT
GCACTCAGAGAAGGACTACCACTCAGGAAATCTGAGCACGCTTTCTACTTGGACTGGGCTGTTCACTCCTTCAGGATCACCAACTG
TGGCGTCCAAGACAGCACCCAGATCCACACTCACATGTGCTACTCCCACTTCAACGACATCATACACTCCATCATCGACATGGATG
CTGATGTCATCACCATCGAGAACTCCCGATCTGATGAGAAGCTTCTCTCCGTGTTCCGTGAGGGAGTGAAGTACGGTGCCGGTATT
GGTCCAGGTGTCTATGACATCCACTCTCCAAGAATACCATCTTCTGAGGAAATCGCGGACAGAGTCAACAAGATGCTTGCTGTCCT
TGAGCAGAACATCCTCTGGGTTAATCCTGACTGTGGTCTTAAGACCCGTAAGTACACAGAGGTCAAGCCTGCCTTGAAGAACATGG
TTGATGCGGCTAAACTCATCCGCTCCCAGCTCGCCAGTGCCAAGTGAAGAGAAGCTTGAAAATGAGATGAATGATTTGAACAAGGA
AACGAGTTCTTTTTATCTATAATTGTTGTGTTTTTGTTTGGTTTTATCACTTTCTAAAAATATTTTAGTCGAAGTTAGATTCGATG
CATTTGCTGTAATGTTTGTTTCTTTTTGTCTCCTTTATTTCTCTGATGGAATGTCTTTCTCTAAAGTCTCTTGAAAGAAATAAAAG
ATTGAATCTTATACA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002871787 cobalamin-independent methionine synthase [Arabidopsis lyrata subsp. lyrata]29290.0
NP_197294 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase [Arabidopsis thaliana]29210.0
CAE55863 cobalamin-independent methionine synthase [Arabidopsis thaliana]29160.0
AAL09712 AT5g17920/MPI7_60 [Arabidopsis thaliana]29140.0
AAN31836 putative 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase [Arabidopsis thaliana]29090.0

Swiss-Prot top hits (Blast detail)Scoree value
O50008 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase29210.0
P93263 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase26654e-300
Q42699 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase26502e-298
Q42662 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase26172e-294
B4EJ37 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase15606e-172

TrEMBL top hits (Blast detail)Scoree value
Q6KCR2 Cobalamin-independent methionine synthase29160.0
Q93ZK3 AT5g17920/MPI7_6029140.0
Q8H162 Putative 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase29090.0
Q9SRV5 Cobalamin-independent methionine synthase27723e-311
Q94BN4 Putative methionine synthase27696e-311

Arabidopsis top hits (Blast detail)Scoree value
AT5G17920.1 ATMS1; 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase/ copper ion binding / methionine synthase29220.0
AT5G17920.2 ATMS1; 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase/ methionine synthase29220.0
AT3G03780.1 AtMS2; 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase/ methionine synthase27731e-313
AT3G03780.2 AtMS2; 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase/ methionine synthase27731e-313
AT3G03780.3 AtMS2; 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase/ methionine synthase27731e-313

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  24%
 
182  10%
 
61  5%
 
191  5%
 
123  14%
 
71  5%
 
211  5%
 
116  29%
 
201  5%

Unigene MembersMember information