Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13762

FASTA Sequence
Unigene ID: UN13762Length: 1076 SSRSNP
GGAGAGAGAGAGAGAGAGAAGAAGAAGAAAGTTTGTTCCGTTACAGCCTCACAATTGCAACAAAGTTTCGTATAAAAGAAGACATA
AATTTCGCTGGTTCCTCCTTTGTCTGAGGTAACCAGAAAAAAAAACTCATTGTCAAATTTCTTTTCTTTTTTTTCTTTTGTGGGTT
TCCTTCTTTAATTGCTTCCTCAGACGAGCTCTTGATCTGGTTCACTTATTAGGATCCTGGAGAGGAGGAAACAACAAACAAACAAA
AAAACCCCAAAAAAGAAAGAGAGAGAGAAAACAAAAAAGAATGTCTTTCACAGGAACTACTGACAAATGCAATGCTTGCGATAAGA
CAGTCTATGTGATGGACATGTTGTCCATTGAAGGAATGCCTTACCACAAGTCTTGCTTCAAATGCACCCATTGCAAAGGCACCCTT
GTGATGAGCAACTATTCATCCATGGACGGAGTCTTGTACTGCAAGACTCATTTTGAGCAACTCTTCAAGGAATCTGGCAATTTCAG
CAAAAATTTCCAACCAGGAAAAACTGAGAAGCCGGAGCAGAATAAGACTCCAAGCAAGATATCTTCAATCTTCTGTGGAACACAAG
ACAAGTGTGCTGCTTGTGAGAAAACTGTTTACCCTCTTGAAAAGGTGCAAATGGAAGGAGAATGCTTCCACAAGACATGTTTCAAG
TGCGCTCACGGTGGCTGCACGCTGACTCATTCCTCGTACGCTTCCCTGGATGGCGTTCTCTATTGCCGGCATCACTTTAACCAACT
CTTCCTCGAGAAAGGCAACTACGCTCACGTTCTCCAAGCAGCCAACCACCGTCGCACGGCCTCAGGCAACACTCTTCCTCCGGAGA
CCACTGAAGAGGTAGCCGTCGAAGCCAAAGAAGAGAACGACGTTTCAGAGTCTTGAAAACAAAAACATCTTCCGTTGATCAGTTTG
TGAGTGATTTGAATTCAATGTTGCGACCAAAGATTTGATTTAATTTGTAATGAGTTATTGTTTCCATATGGACACATTATTTAATA
TTTTGTTTTCGTTATTTATACATAATTTACACGGCAAAGAAAGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAF78411 Contains similarity to mRNA for transcription factor L2 from Arabidopsis thaliana gb|X91398. It contains LIM domain containing proteins PF|00412. ESTs gb|T13084 and gb|T42925 come from this gene10962e-117
NP_171683 LIM domain-containing protein [Arabidopsis thaliana]10613e-113
XP_002892043 LIM domain-containing protein [Arabidopsis lyrata subsp. lyrata]10603e-113
XP_002511828 Pollen-specific protein SF3, putative [Ricinus communis]8821e-092
XP_002302574 predicted protein [Populus trichocarpa]8354e-087

Swiss-Prot top hits (Blast detail)Scoree value
P29675 Pollen-specific protein SF35242e-052
Q4U4S6 Xin actin-binding repeat-containing protein 22114e-016
Q1LZA7 LIM domain-containing protein 22008e-015
Q9BT23 LIM domain-containing protein 22008e-015
Q8BGB5 LIM domain-containing protein 21972e-014

TrEMBL top hits (Blast detail)Scoree value
Q9LQ78 T1N6.19 protein10962e-117
Q1ECF5 AT1G01780 protein10612e-113
B9RDN9 Pollen-specific protein SF3, putative8821e-092
B9GPY8 Predicted protein8353e-087
B9ICB0 Predicted protein8121e-084

Arabidopsis top hits (Blast detail)Scoree value
AT1G01780.1 LIM domain-containing protein10628e-116
AT2G45800.1 LIM domain-containing protein8073e-086
AT3G61230.1 LIM domain-containing protein7912e-084
AT2G39900.1 LIM domain-containing protein6712e-070
AT3G55770.1 LIM domain-containing protein6577e-069

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
910  29%
 
66  17%
 
813  37%
 
114  11%
 
121  3%
 
71  3%

Unigene MembersMember information