Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13904

FASTA Sequence
Unigene ID: UN13904Length: 728  SNP
TTTTGTGAGAAGTATGAGATTGAGAAGGTTGATATGGAAGATGAATTGGATCACCCAAAGAGACATCAACATCAATCCTTGTTGCA
AAATAACAAATAGAATAAATAACTTATATCGGACATTCCTTTAATAATCAATAAGAACTTGATCATTACAAGAAAACAAACCATGC
AACCATTTTCTTAAAGACCTTATTAATTAAGGAGCAACTAAGAAACTTAAGCTTTTTTACAAGTGAGTTGAATAAAAAACTTAGCC
TCTTTATTGCAGTGACTCGTACCAAACATCTCGTCCGAAGTCATAAACACACATATGTTTTTTCCAACACAATTCTTTTTGGCGAC
CTTCAAGGCAGCTTCTGCGCCGCAATTTCCATGTCTATAGTGTTCACACTTGCCGGAAGGATCTCCATAATCAGCAAAATTGATCT
TTGTAAAAACTTCTTTAGACTTATTGCAACCAAGCACCCACGGATATTCCATAGTAGATTCTGCACAGATAATATATTCCTTGCCC
ATGTCTGTGCCATAATGAGTGTAAGTATATTGATCTTCAAAGAAACTGTCGGTTTTGTTGCCTCTTGCATCATTGGAAGAAATATT
CATATTGGAAGCTAAACCAAGCACAGAGGAATAAGATAGAACTAGAAGAAAGATGTAGCCTCGACGACGGCTATGCGAAGTATCCA
TTTTGTTGTCTCCGTAATCAAAAGTAACAAAAAGTAGTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002876187 predicted protein [Arabidopsis lyrata subsp. lyrata]3343e-029
NP_001118829 D-galactoside/L-rhamnose binding SUEL lectin protein [Arabidopsis thaliana]3056e-026
NP_190876 D-galactoside/L-rhamnose binding SUEL lectin protein [Arabidopsis thaliana]2984e-025
ABK28602 unknown [Arabidopsis thaliana]2984e-025
AAM63449 unknown [Arabidopsis thaliana]2851e-023

Swiss-Prot top hits (Blast detail)Scoree value
P49676 Beta-galactosidase1378e-008
Q9SCW1 Beta-galactosidase 11332e-007
P48980 Beta-galactosidase1271e-006
Q8W0A1 Beta-galactosidase 21234e-006

TrEMBL top hits (Blast detail)Scoree value
B3H6K7 Uncharacterized protein At3g53075.13054e-026
A0MF27 Putative uncharacterized protein (Fragment)2983e-025
Q9SCQ3 Galactose-binding lectin family protein2983e-025
Q8LCR5 Putative uncharacterized protein2859e-024
B3H4Y0 Uncharacterized protein At3g53065.12543e-020

Arabidopsis top hits (Blast detail)Scoree value
AT3G53075.1 beta-galactosidase/ sugar binding3062e-028
AT3G53080.1 galactose-binding lectin family protein3001e-027
AT3G53065.1 beta-galactosidase/ sugar binding2542e-022
AT3G53050.1 galactose-binding lectin family protein1772e-013
AT3G13750.1 BGAL1 (Beta galactosidase 1); beta-galactosidase/ catalytic/ cation binding / heme binding / peroxidase/ sugar binding1332e-008

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
104  17%
 
114  17%
 
94  17%
 
84  17%
 
72  8%
 
122  8%
 
64  17%

Unigene MembersMember information