Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13956

FASTA Sequence
Unigene ID: UN13956Length: 1892  SNP
GGCCATCTCAAACAAACTTCCAATTAGAGACAATTCACAAAACATACTTCAGATTCTTCCCTCTGTTGAAAGACGAATTGGGTCTC
GATCAAAATTAGAAATAATGGATTTCTCCGGCATGTTTCTCACTTTGGTCTTGGCGGCTCTGTTTCTCTGTTTACTCCGGTTCTTA
GCCGGATTCCGTCGTAGCTCCTCCTCGAAACTCCCTCTTCCTCCGGGAACAATGGGTTATCCTTACGTCGGCGAAACATTCCAGCT
TTACTCACAAGACCCTAATGTCTTCTTCGCATCAAAACAGAAAAGATACGGATCGGTGTTCAAGACTCATGTACTGGGATGCCCAT
GTGTGATGATCTCGAGCCCTGAAGCTGCCAAGTTCGTATTGGTTACAAAGTCACATTTGTTTAAACCTACTTTTCCGGCTAGCAAA
GAGAGGATGCTCGGAAAGCAAGCCATCTTCTTCCACCAGGGAGATTACCATGCTAAACTCAGGAAGCTCGTCTTAAGAGCTTTCAT
GCCTGATTCAGTCAGAAACATGGTCCCACACATCGAATCAATTGCTCAGGAATCTCTCAATTCCTGGGATGGAACTCAGCTCAACA
CTTACCAAGAGATGAAAACATACACTTTCAACGTGGCGTTAATCTCAATACTCGGACAAGACGCAGTCTTTTACCGTGAAGATCTG
AAACGATGCTACTACATTCTTGAGAAAGGTTACAACTCGATGCCGATTAATCTCCCGGGAACACTATTCCACAAAGCCATGAAAGC
TCGCAAGGAGTTAGCTCAAATCCTCGCTAACATCTTAGCCAAAAGAAGACAGAACCCATCCACGCACAAAGATCTTCTTGGATCAT
TCATGGAAGACAAAGAAGGGTTAAGCGACGAACAAATCGCTGACAACATAATCGGAGTTATCTTCGCGGCAAGAGACACGACAGCG
AGTGTGCTGACGTGGATCCTCAAGTACTTGGCAGATAATCCAACTGTCCTAGAAGCTGTCACTGAAGAACAAATGGCGATAAGGAA
AGGGAAGAAAGAAGGAGAGAGTCTCACTTGGGAAGATACAAAGAAGATGACACTAACTTCTAGAGTTGTCCAGGAGACAATGAGAG
TTGCTACAATCTTATCTTTCACATTCAGAGAAGCTGTTGAAGATGTTGAATACGATGGATACTTGATACCAAAGGGATGGAAAGTA
CTGCCACTATTCAGAAATATTCATCACAATGCTGATTTCTTTTCGGATCCGGGAAAGTTTGATCCTTCAAGATTTGAAGTTGCGCC
GAAACCAAATACATTCATGCCATTTGGGAATGGGATCCATTCTTGTCCGGGCAATGAGTTAGCTAAACTTGAAATCTCTATTCTAA
TCCATCATCTCACCACTAAGTACAGGTGGTCAATTATGGGACCTAGCGATGGAATTCAGTATGGACCGTTTGCTCTTCCTCAAAAT
GGATTGCCTATTGCCTTAGAGCAAAAACCAGAGGTGGACGTTTAGAAAATTACAAGAGCACCTTCGTAGCTTTCTAAAGTTTGAAA
GTGGAAGATTCTTTTTCATTCGAGTGAGAAAATTACTTCATTGGCTAAGAAATAAAAAAAATATTAGAGATGAAAAGGGAATAGGA
AAGGAAAATCCCTATTGGGATCCCAAGTGTATATAGTTTTCAGTGATTTTAATATTTTTAGTTTAGGTTTATGAAATGTAGAGAAT
TAAATTTTGGGAGCAATACGAAAACAGGTTATATAATTTTTAACGTGTATGTAAGCTGGCTAGTCCGTTAATGAGACTTTCCCTCC
TTTTGTTGTTATTTCTCTCAAATTGTAAATTATTTTGTTATATCAATGCAGTGAATAAAATTACGGAATGCTCAAAGAAAATATCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_851136 abscisic acid 8'-hydroxylase 3 [Arabidopsis thaliana]22982e-256
XP_002863488 predicted protein [Arabidopsis lyrata subsp. lyrata]22435e-250
NP_199347 abscisic acid 8'-hydroxylase 3 [Arabidopsis thaliana]21413e-238
NP_567581 abscisic acid 8'-hydroxylase 1 [Arabidopsis thaliana]21217e-236
NP_974574 abscisic acid 8'-hydroxylase 1 [Arabidopsis thaliana]19845e-220

Swiss-Prot top hits (Blast detail)Scoree value
Q9FH76 Abscisic acid 8'-hydroxylase 322988e-258
Q949P1 Abscisic acid 8'-hydroxylase 121213e-237
Q09J79 Abscisic acid 8'-hydroxylase 116625e-184
Q05JG2 Abscisic acid 8'-hydroxylase 116625e-184
O81077 Abscisic acid 8'-hydroxylase 214555e-160

TrEMBL top hits (Blast detail)Scoree value
A8MRX5 Uncharacterized protein At4g19230.219844e-220
B9RY37 Cytochrome P450, putative18941e-209
B9N0P8 Predicted protein18922e-209
Q3HNF4 ABA 8'-hydroxylase CYP707A118349e-203
B1B1U1 ABA 8-oxidase18276e-202

Arabidopsis top hits (Blast detail)Scoree value
AT5G45340.1 CYP707A3; (+)-abscisic acid 8'-hydroxylase/ oxygen binding22987e-259
AT5G45340.2 CYP707A3; (+)-abscisic acid 8'-hydroxylase/ oxygen binding21411e-240
AT4G19230.1 CYP707A1; (+)-abscisic acid 8'-hydroxylase/ oxygen binding21222e-238
AT4G19230.2 CYP707A1; (+)-abscisic acid 8'-hydroxylase/ oxygen binding19842e-222
AT2G29090.1 CYP707A2; (+)-abscisic acid 8'-hydroxylase/ oxygen binding14554e-161

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
63  20%
 
82  13%
 
105  33%
 
213  20%
 
201  7%
 
121  7%

Unigene MembersMember information