Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13995

FASTA Sequence
Unigene ID: UN13995Length: 913 SSRSNP
GGGATCCACGCATAAACTCAAACTTCAAACACACAATGGCAACCATTCATCTAACGCTAGCTCCTCTCCTCCTCCTCCTCGCCGCC
ATCTTCCTCTCCACGGAGGTAACTGCTCAGCCCGCCGCTCCTGCTCCTGGCCCTACCGGTCCCATCAACATCACAGCGATCCTAGA
AAAAGGCGGTCAGTTTGTTACTTTTATCCGTCTTCTAAACACAACTCAAATCGGAAGCCAAATCAACATCCAAATCAACAGTTCAT
CAGAAGGCATGACCGTATTCGCACCAACGGACAACGCTTTCCAAAACCTTAAACCGGGAGCCCTAAACAAGTTAAGCCCGGACGAC
CAAGTCAAGCTCATTCTTTACCATGTTAGTCCCAAGTTCTACACAATGGATGATCTTCTCTCCGTAAGCAACCCTGTCAGAACACA
AGCTACTGGTCGAGACGGTGGAGCGGTTTACGGACTTAACTTCACCGGTCAAGGGAACCAAGTGAACGTGTCGACAGGTGTCATCG
AGACACGTGTCAGTAATGCACTGAGAAAAGAACGTCCACTTGCGGTTTACGTGGTGGACATGGTATTGTTGCCTGAAGAGATGTTT
GGAGACCGCAAGAAGATCTCACCGGTGGCGCCTGCTCCAAAATCCAAATCTCCTGCTGTCTCTGATGACTCATCAGACGACTCCTC
TAAGAAAGCGGCGGTTCCGTCCCAGAAGTCTGGCTCCGGTGAGATGAAGGCTGGATTAGGCTTTGGTCTTGGATTTGTTCTCTTAT
GTTTAAAATTCATTGTTTAATTGTGCTGCTTTATTTTTTATTTAATTGTGTGGGTTGTGTAATAAGAAACTTGTGTATTGAATATG
ATGTATCATGCTGCATGGATTGAAAACTGAAATAAGATTTTTTTTTTTTTTTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002865383 hypothetical protein ARALYDRAFT_494579 [Arabidopsis lyrata subsp. lyrata]10235e-109
NP_199226 fasciclin-like arabinogalactan protein 13 [Arabidopsis thaliana]10218e-109
XP_002892185 hypothetical protein ARALYDRAFT_470362 [Arabidopsis lyrata subsp. lyrata]9796e-104
NP_563692 fasciclin-like arabinogalactan protein 9 [Arabidopsis thaliana]9752e-103
AAN60339 unknown [Arabidopsis thaliana]9715e-103

Swiss-Prot top hits (Blast detail)Scoree value
Q9FFH6 Fasciclin-like arabinogalactan protein 1310223e-110
Q9ZWA8 Fasciclin-like arabinogalactan protein 99883e-106
Q9SIL7 Fasciclin-like arabinogalactan protein 66452e-066
Q8LEJ6 Fasciclin-like arabinogalactan protein 114901e-048
Q8LEE9 Fasciclin-like arabinogalactan protein 124311e-041

TrEMBL top hits (Blast detail)Scoree value
B3LF88 At1g038709751e-103
A0T2P3 Putative uncharacterized protein9411e-099
B9IQS4 Fasciclin-like arabinogalactan protein 9.26632e-067
A5BN83 Putative uncharacterized protein6622e-067
B9RVS1 Putative uncharacterized protein6533e-066

Arabidopsis top hits (Blast detail)Scoree value
AT5G44130.1 FLA13 (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 13 PRECURSOR)10232e-111
AT1G03870.1 FLA9 (FASCICLIN-LIKE ARABINOOGALACTAN 9)9882e-107
AT2G20520.1 FLA6 (FASCICLIN-LIKE ARABINOGALACTAN 6)6478e-068
AT5G03170.1 FLA114901e-049
AT5G60490.1 FLA124319e-043

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
116  18%
 
911  32%
 
63  9%
 
810  29%
 
122  6%
 
102  6%

Unigene MembersMember information