Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14031

FASTA Sequence
Unigene ID: UN14031Length: 1061  SNP
GGACCAAAAACCACAATCGTCAATCCTCAGCAAAAGGAAAACACATACAGAGAGAGAGATGGCGACGACAACAGCAGAGGCAACGA
AGACATCTACTAATAATGGAGAAGACAAGCAATCTCAGAATCTCCGACATCAAGAAGTTGGTCACAAGAGTCTCTTACAGAGCGAC
GATCTCTACCAGTATATTCTGGAGACAAGTGTGTATCCAAGAGAACCAGAATCAATGAAAGAACTCAGGGAAGTGACAGCAAAACA
CCCTTGGAACATAATGACAACATCAGCAGATGAAGGACAGTTTCTGAACATGCTCATCAAGCTCGTTAACGCCAAGAACACAATGG
AGATCGGTGTTTACACTGGCTACTCTCTCCTCGCCACTGCTCTTGCTCTCCCCGAAGACGGCAAAATTCTTGCTATGGATGTTAAC
AGAGAGAATTACGAATTGGGTTTGCCGATCATCGAGAAAGCCGGCGTTGCTCACAAGATCGATTTCAGGGAAGGCCCTGCTCTTCC
CGTTCTTGATCAACTCGTTGCTGACGAGAAGAACCATGGAACATATGACTTTATATTCGTTGATGCTGACAAGGACAACTATATCA
ACTACCATAAGCGTTTGATTGATCTTGTGAAAGTTGGTGGAGTGATTGGCTATGACAACACTTTGTGGAACGGTTCTGTCGTTGCT
CCTCCTGATGCACCAATGAGGAAGTATGTTCGTTATTACAGAGACTTTGTTCTTGAGCTTAACAAGGCTCTTGCTGCTGACCCTAG
GATTGAGATCTGCATGCTTCCTGTTGGTGATGGAATCACTATCTGCCGTCGGATCAGTTGATTTGATACCTCCAACACTCTGAGTT
TGTCTGCAGTGGATCAATTCTCCTCTCTCTACTACCTACCAAATTGGACCACTCATATGTATTTTGTTAAGGCATTGTCTTTTGTT
TTTGCTTTTCTTCTGAACAAAGAAATAATGTACCCTACCTTTCTTGTTTTGTTTGTTTTTCCCTTATGATACAACTTCTAAAACAA
TATATCACTCATTTAAATTTTGTGAAGAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABE41833 caffeoyl-CoA 3-O-methyltransferase [Brassica rapa subsp. pekinensis]13231e-143
NP_195131 putative caffeoyl-CoA O-methyltransferase [Arabidopsis thaliana]13103e-142
AAM66108 caffeoyl-CoA O-methyltransferase-like protein [Arabidopsis thaliana]13032e-141
AAZ95245 putative caffeoyl-CoA O-methyltransferase protein [Isatis tinctoria]13032e-141
AAW55668 caffeoyl CoA 3-O-methyltransferase [Betula platyphylla]12111e-130

Swiss-Prot top hits (Blast detail)Scoree value
O49499 Probable caffeoyl-CoA O-methyltransferase At4g3405013101e-143
Q43095 Caffeoyl-CoA O-methyltransferase11821e-128
O65862 Caffeoyl-CoA O-methyltransferase 111811e-128
O04899 Caffeoyl-CoA O-methyltransferase 511783e-128
Q9SWB8 Caffeoyl-CoA O-methyltransferase 211765e-128

TrEMBL top hits (Blast detail)Scoree value
A6XBP7 Caffeoyl-CoA 3-O-methyltransferase13237e-144
Q0ZUG5 Putative caffeoyl-CoA O-methyltransferase protein13031e-141
Q5I2D1 Caffeoyl CoA 3-O-methyltransferase12117e-131
B8XPP9 Caffeoyl-CoA O-methyltransferase12091e-130
A4ZKM6 Caffeoyl-CoA 3-O methyltransferase11964e-129

Arabidopsis top hits (Blast detail)Scoree value
AT4G34050.1 caffeoyl-CoA 3-O-methyltransferase, putative13111e-144
AT4G26220.1 caffeoyl-CoA 3-O-methyltransferase, putative7203e-076
AT1G67980.1 CCoAMT; caffeoyl-CoA O-methyltransferase6424e-067
AT4G34050.2 caffeoyl-CoA 3-O-methyltransferase, putative6291e-065
AT1G67990.1 TSM1; N1,N5,N10-tris-(5-hydroxyferuloyl)spermidine O-methyltransferase/ caffeoyl CoA:S-adenosyl-L-methionine O-methyltransferase/ caffeoyl-CoA O-methyltransferase/ tricaffeoyl spermidine:S-adenosyl-L-methionine O-methyltransferase/ trihydroxyferuloyl sper6057e-063

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
69  23%
 
78  21%
 
97  18%
 
123  8%
 
105  13%
 
113  8%
 
84  10%

Unigene MembersMember information