Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14042

FASTA Sequence
Unigene ID: UN14042Length: 725  SNP
TTTTTTGTAGCAGAACAGCGGAAGAACATGGGAATAAGTTCAGAACATAGCAACTTTATTAGAACTTGAGTAACAATCTTCTCATA
GTTTTTACATACACTTAAGTGTGCAGAGAGAATCAGAAGATAGAACAATAGACGCTCAGCTACTTTACTTGGTGACGGTGAAGCTT
GCACGGAAGTTTGATATCATAACCGGGCACTCGCCCTTCTCATCATACTCCGTGAACTCCTCTCCGCTCGACAAATCAATCTCATC
AAACTTAGTTCCAGATTCAGCTTGAGCTTTCCAAAATCCGCCAAACCCGAAATCGATTGGCTCATATCCTCGACAGTCAAAGACCA
TAAGAGGAGCATGTTCTCCAGCCTCGGAATCTTCAAGAGTTAAAGGTCGACCTTTCCCCGGGATCATTGTCACATTCCCTTCCCTT
CCACAGAACTTACACTTCTGAACAAGATGACAAGAACCCCTGCCACCAGGAGGAGTAAAAGTCTCATTCAAAGTCACACATGTTTC
CTTCTGAGTCACCTCTCCGCATCTTTCACATTTCAACTTGAAGAGGTAAGGGAAGTTGGGATCGTCGCAGCCACCGGAAGGCTGGA
GATTAGTGAGATTCTCGAGATCTGCCGTTATTTTAAGCACATAGTTCACCATCTTCCTTCTCCACACGATTCTCCTTCTTCTTCTG
CTTCTTCTGATCGTGGTGGTGGTGCTTTACGGAGCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_567911 uncharacterized protein [Arabidopsis thaliana]8934e-094
BAJ34199 unnamed protein product [Thellungiella halophila]8862e-093
XP_002869232 hypothetical protein ARALYDRAFT_353533 [Arabidopsis lyrata subsp. lyrata]8801e-092
CAA21202 putative protein [Arabidopsis thaliana]7171e-073
ACU15162 unknown [Glycine max]6604e-067

Swiss-Prot top hits (Blast detail)Scoree value
Q3B8G0 UPF0587 protein C1orf123 homolog2972e-026
Q9NWV4 UPF0587 protein C1orf1232731e-023
Q9BI88 UPF0587 protein F46B6.122677e-023
Q32P66 UPF0587 protein C1orf123 homolog2669e-023
Q8BHG2 UPF0587 protein C1orf123 homolog2651e-022

TrEMBL top hits (Blast detail)Scoree value
Q8L948 Putative uncharacterized protein8933e-094
O82636 Putative uncharacterized protein AT4g329307177e-074
C6T0W7 Putative uncharacterized protein6603e-067
C6T594 Putative uncharacterized protein6504e-066
B7FIJ9 Putative uncharacterized protein6398e-065

Arabidopsis top hits (Blast detail)Scoree value
AT4G32930.1 unknown protein8941e-096

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  24%
 
94  19%
 
62  10%
 
125  24%
 
71  5%
 
114  19%

Unigene MembersMember information