Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14059

FASTA Sequence
Unigene ID: UN14059Length: 1537  SNP
ATACAAGGAAATATATTTTGGTTTTAAGGTATTTGTTTCAGATTATTGAAAGGGAGTTCTACAAAAGACAAGTCTTAAGTAACTGC
AGAAAGGAACAAGAGTTACAGATACTAGATTGTGTTTAGTAAAGCCAATAAAAAACTTTGGAAACAGAAAATACAGTTTGGTTCAT
CTCTCGAAGTTGTATAAAGCTTCAAGATCTGGAGAGGATACCACGAAATAGGTAAAAAGACAAGATTGGAATCTCTCATTTCTTCC
CACCACCGGAAACGTTGAACTTGAAGAAAATGATATCTCCGTCCTGAACAACATATGTTTTCCCCTCCTGTCTGTATTTTCCTGCC
CCCTTGACTGCAGTTTCATTGCCAAGTTCCTTGAGATCCTCAAACTTCATGACCTCGGCACAAATGAATCCTCTCTCAAAATCAGT
ATGAATGGCCCCTGCAGCTTGAGGAGCCTTTGACTGACGTCTTATTTGCCAGCACTTCACCTCATCAGGCCCTGCTGTAAAGAAAT
ATATGAGGTTAATAGCTGAAAATCCAGTTTTGATGATCCTCGGAAGAGCACTTTGCAGTTTGTTCTCCTCACAATACTTTGCTGCT
TCGTCTGGGAGCATATCAGCGAGACTCCTTTCGAAAACACCACTGAAAGGAATCATAGTATCACCACCGTGTTCTTGAACCCAAGC
ATGAATCTTCGGCAGGAACTTGTTTTTCTTCCTCTGGTAGTCTCTCTCATTCATGTTAATCAAGTAAACAACGGGCTTAGCGGAAA
GCAATTGGAAAGTGTTCAAAATCTCGATATCAGCTGCTTTCCAGTCCCCAAAACGGACATCCTTTCCTTCTTCCAGCCAAGCTTTT
ACCTTTAGCAAGAGCTCAAGTTCGACTTTAAGCGCCTTGTCATTGCTCCTCTTCATGCTCTTCTCGACATCTTCGATCTTCTTTTT
AATGAATTCAATATCCTTTAGACGCAATTCTTCAGTAATGGTCTCCAAATCTCTAACAGGATCCACAATATCATCAACATGAATAA
TATCAGGATCTTCAAAGGCACGTAGAACATGGAAGATGCCATCAACAGCACGAATATGAGACAAGAAGTTGTTTCCAAGACCCTGT
CCTTCATGAGCGCCTCGAACAAGGCCAGCAATGTCATGAATTTCCAAGAAAGCAGGAATCTCACTCTTGGGCTTGTACAAATGACA
AAGCCAATCAAACCTGTCATCGGGGATGTTGACACGTGCCTCGTTGGGCTCAATGGTACAAAAGGGGAAGTTCTCAGCTGGGATTG
AAAGCTTCGTTAGGGTGTTGAAAAGTGTTGACTTTCCCACGTTTGGTAACCCTACGATTCCGATCTTGAGGTGAGAAGAGAAACGG
CCAAGGATTGGCCTCTCTACGGGACCTGCATCCTTTGCTTTCCCTTTCGGAGGCATCCTTTCTCTCTCTATTAGTGTCGACCTTCA
AGGAGGAGGAGCTTAGATAGATTCGCTTCGCTTCGCTAGGGTTCGTTTTCTTTAGCTGAGTTGCTGCGAAGCTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002893634 GTP binding protein [Arabidopsis lyrata subsp. lyrata]19881e-220
NP_174346 GTP-binding protein [Arabidopsis thaliana]19862e-220
AAM63059 putative GTP-binding protein [Arabidopsis thaliana]19819e-220
XP_002330603 predicted protein [Populus trichocarpa]18511e-204
XP_002263885 PREDICTED: hypothetical protein [Vitis vinifera]18358e-203

Swiss-Prot top hits (Blast detail)Scoree value
Q5ZM25 Obg-like ATPase 112521e-136
Q7ZU42 Obg-like ATPase 112369e-135
Q7ZWM6 Obg-like ATPase 112224e-133
Q9NTK5 Obg-like ATPase 112215e-133
Q2HJ33 Obg-like ATPase 112207e-133

TrEMBL top hits (Blast detail)Scoree value
Q9SA73 At1g3058019862e-220
Q8LDR5 Putative GTP-binding protein19816e-220
B9N5P8 Predicted protein18517e-205
B9SB24 GTP-dependent nucleic acid-binding protein engD, putative18339e-203
B9GH21 Predicted protein18231e-201

Arabidopsis top hits (Blast detail)Scoree value
AT1G30580.1 GTP binding19877e-223
AT1G56050.1 GTP-binding protein-related6865e-072

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
76  23%
 
87  27%
 
123  12%
 
62  8%
 
213  12%
 
91  4%
 
103  12%
 
111  4%

Unigene MembersMember information