Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14065

FASTA Sequence
Unigene ID: UN14065Length: 957  SNP
GGACAAGTACTAGCTAGCAGCAGGTGACATAGTATTTCTAAACAGGGGTTCAATTCACTGAAACCAATGAAAATGCAAGCAGTTCT
CATCATCCTGGTTTTCTCCGGTTTACTGGCAGTTAAGACAACGTTAGCAGCACAACATGTGATAGGCGGGAGCCAAGGCTGGGAAC
AATCCGTTGACTTTGATTCTTGGACGTCCGATAAATCTTTCAAAGTCGGGGACCAACTTGTTTTTAAGTATTCCGGACTACACAGC
GTTGTAGAGCTGGGAAGCGAAGCGGCATACAAGAGTTGTGACCTGGGAACACCTGTAAATTCCTTAAGCTCTGGGAACGACGTCGT
TAAGCTTTCTAAAACCGGTGCTCGTTATTTCGCATGTGGGACCCCAGGGCATTGCGAATCAGGCATGAAGGTTAAAGTCAACGTTG
TCTCTGCTGACTCCACCGCCGTTTCCTCTCCGGGTTCGGATTCAAGCTCCGACTCAGATTCCGGTTCGAACAGCGGCTCATCTCCG
GGTTCGGGCTCGAGCTCCGGGTCGAGTTCGAGTTCGGGTCATGGGTTACGTGTTTCCATTGGGTATATATTGGCCGTTGGATCGTT
GGTTATTGGTCTTATTTGGGCTTTCTGAGGACTAAGGCTTTTGTATTGTTGCATCGAGGAATATATTTTGGGAGGGGAGAATATAA
ATAAACTTTCGAATTATTAATCCGTATTTGTTGTATTTTGCGAATTTGCGTCATTATGTATTTCGAATATTGCATTTCTGATTTTG
TTATTGTATCCGTATTTCTCAGTTACTATGGTTTTCTCACCCTCTTGTCCACTTGATTGGTCCGGTTGGAATATTTTTTTTTTTGT
AAAAGAGAATATTCTCTATTTTGCCTTTTTAATATGCCCACTTTTTTGTCAACATATGCCCCACTTTTTTTTTTGTCGTCAAACCC
ACTTTTAATAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002877026 hypothetical protein ARALYDRAFT_484503 [Arabidopsis lyrata subsp. lyrata]6572e-066
NP_566810 plastocyanin-like domain-containing protein [Arabidopsis thaliana]6463e-065
AAM62707 blue copper protein, putative [Arabidopsis thaliana]6293e-063
BAB02115 unnamed protein product [Arabidopsis thaliana]6042e-060
ACU13756 unknown [Glycine max]4742e-045

Swiss-Prot top hits (Blast detail)Scoree value
Q41001 Blue copper protein2616e-022
O80517 Uclacyanin-22275e-018
P80728 Mavicyanin2185e-017
Q07488 Blue copper protein2132e-016
P00302 Stellacyanin2096e-016

TrEMBL top hits (Blast detail)Scoree value
Q8VY59 At3g272006462e-065
Q8LED5 Blue copper protein, putative6292e-063
Q9LK33 Genomic DNA, chromosome 3, TAC clone:K17E126041e-060
C6SWY3 Putative uncharacterized protein4742e-045
B9RBK2 Blue copper protein, putative4599e-044

Arabidopsis top hits (Blast detail)Scoree value
AT3G27200.1 plastocyanin-like domain-containing protein7061e-074
AT3G60270.1 uclacyanin, putative2858e-026
AT2G32300.1 UCC1 (UCLACYANIN 1); copper ion binding / electron carrier2598e-023
AT5G07475.1 plastocyanin-like domain-containing protein2571e-022
AT5G26330.1 plastocyanin-like domain-containing protein / mavicyanin, putative2454e-021

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
65  14%
 
94  11%
 
109  24%
 
1111  30%
 
77  19%
 
201  3%

Unigene MembersMember information