Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14095

FASTA Sequence
Unigene ID: UN14095Length: 810  SNP
GGTTAAGAGGCAAAATTCTTTTTGTCCGCTTTAGAGTCGTCATACAAATCCGGACATGCACTGCCAAATGGGTTTATCGTCATTGT
CTCATTGGGTCTCCAATGAATCTCAACAGCTGAGTGTACTTATTATCACAAAATCACAGCAAAAGAAAGAGAGAAAAATGAGAAAG
AAAAGTGAATGTATGTTTCACAGGCCGAAGATACAAGAAGCAATGATCAGTATCCCCAGTAGTCGTTACGGATTTCATCATCAAAC
TTCTTTTTGAGTTCTGGGTGCTTCTCAAAGTACTCATCTGCAGTCATGGTGCTGAGCTTTTTGCTAATCTCCTGGACATCAACAAT
TTCTTTCTCCAGACGTTCAGACTCCTTGAGCGATTTCTGTTCTGCTTCTTTCAGTTCCACCAACAAAGCATCGAACTTTGGCTTGT
ATTCAGGAGTAACAGTGTCCACGAACTTGGGAATCTCAACGCTGTCATAAGCTTCCTTGTACATGTCAACAATGCCAGACCCAATA
CCCTTTCTGTAGAAATCCCAATCAATGGGTTCAGGCTCCTGACTGAACTTGGTCTGGAGCTGAGTGTTAACCTCATCGAAAGCACG
ACGGAGGTTAGAGAACTCTCTTCGAGCCTCGTCGGTTACAAGAACCTTCGCCATCCCTTCCCAATCTATTGTCCTCGACGCTTTGA
ATGCCACATCCGCTATTTTCTTACCGGCTCCGCTCATTTTTTTTCACCCTGATGAAATGCGCGAAGAGGAGGAGGAAGACGAAGAT
GTAAAACGTCGTCCGATCCGACCAATGAAGGGGACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_190798 ATP synthase subunit d [Arabidopsis thaliana]8326e-087
XP_002876134 hypothetical protein ARALYDRAFT_485596 [Arabidopsis lyrata subsp. lyrata]8228e-086
AAT40531 ATP synthase D chain, mitochondrial, putative [Solanum demissum]7672e-079
XP_002277452 PREDICTED: hypothetical protein [Vitis vinifera]7672e-079
XP_002529702 ATP synthase D chain, mitochondrial, putative [Ricinus communis]7672e-079

Swiss-Prot top hits (Blast detail)Scoree value
Q9FT52 ATP synthase subunit d, mitochondrial8323e-088

TrEMBL top hits (Blast detail)Scoree value
A5AY42 Putative uncharacterized protein7671e-079
B9SUN3 ATP synthase D chain, mitochondrial, putative7671e-079
Q6L460 ATP synthase D chain, mitochondrial, putative7671e-079
C6SYC1 Putative uncharacterized protein7662e-079
C6SZJ2 Putative uncharacterized protein7572e-078

Arabidopsis top hits (Blast detail)Scoree value
AT3G52300.1 ATPQ (ATP SYNTHASE D CHAIN, MITOCHONDRIAL); hydrogen ion transmembrane transporter8332e-089
AT3G52300.2 ATPQ (ATP SYNTHASE D CHAIN, MITOCHONDRIAL)5312e-054

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
73  10%
 
89  29%
 
68  26%
 
114  13%
 
94  13%
 
123  10%

Unigene MembersMember information