Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14098

FASTA Sequence
Unigene ID: UN14098Length: 1420  SNP
GCACGAGGCCTCTTACTCTTGTCCTCGCATTTTCCTTCACACACATCCTATCACAACCTCATCATACCATAGCTTCTTCTTTGATC
TTTTTTTTTTTTTTGCCAGAGTGCCACCCCTACTTCTTCTTCTTCCATTATTGATCCAACATGGCTGCTGCTATAGGTGCTGCAGT
CTCTTTTCCATCCTCAAAGTCGTCGTCTCTCCACACCAAAAGCTCCTTCGTTTCCCCTCAAAGGATTTTCCTCAACAACAAGAGCA
CAGTGTGCTACAGAGAGGCGTGTATTTATGGGGGAAGAGTGAAGGCTCAGGTGACAACTGAGACGCCAGTGAAAGTAGCCAAGGAG
TCGAAGAAACAGGAAGAAGGAATTGTTGTCAACAAATTCAAACCAAAGGATCCTTACACTGGTAGATGCCTCTTGAACACCAGGAT
CACTGGCGATGATGCTCCCGGTGAAACCTGGCACATCGTCTTCAGCACCGAAGGTGAGGTTCCATACAGAGAAGGGCAGTCGATAG
GAGTGATTCCAGAAGGAATTGATAAGAATGGGAAGCCCCACAAGCTGAGGTTATATTCAATTGCCAGCAGTGCCATTGGTGACTTT
GGAGACTCCAAAACCGTTTCTCTCTGTGTCAAGAGATTGGTTTACACTAACGAAAGTGGAGAGCTTGTTAAGGGAGTCTGCTCCAA
CTTCTTGTGTGACTTGAAGCCGGGTGATGAGGCAAAGATCACTGGACCAGTTGGGAAGGAAATGCTTATGCCTAAAGACCCAAATG
CCACCATCATCATGCTTGGAACAGGAACTGGAATTGCTCCATTTAGATCATTTTTGTGGAAAATGTTCTTTGAGGAGCACGAGGAC
TACAAGTTCAACGGTTTGGCATGGCTCTTCTTGGGTGTACCCACAAGCAGCTCACTGCTCTACAAGGAGGAGTTTGAGAAGATGAA
GGAGAAGAACCCGGAAAACTTCAGGTTGGACTTTGCGGTGAGCAGAGAGCAGACAAACGAGAAAGGAGAGAAAATGTACATACAGA
CAAGAATGGCAGAGTATGCAGAAGAGCTGTGGGAGTTGCTGAAGAAAGACAACACCTTTGTTTACATGTGTGGTCTCAAGGGTATG
GAGAAGGGTATCGATGAGATCATGGTCTCACTTGCTGCTAAAGATGGGATCGATTGGTTGGAGTACAAGAAGCAATTGAAGAAGAG
TGAGCAGTGGAACGTGGAAGTCTACTAAGCTTGCTAGTTGCTAGTGAGAGGTTTATTACTATGTAGATAAAGGAGCTTATGCCATT
GCCAATTATTCATTTTCTGCATTTTTCCTTTTTTTTTCTCTCTCTTTTTCAACAATATTATGAAATACATGCTCTGTATCATAGTA
GAGAAGAATTTGACATTTGAAAATTAGCAAGTTCAGTGGACCCG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002865083 ferredoxin-NADP+ reductase [Arabidopsis lyrata subsp. lyrata]17254e-190
NP_201420 ferredoxin--NADP+ reductase [Arabidopsis thaliana]17173e-189
BAE98556 ferredoxin-NADP+ reductase [Arabidopsis thaliana]17147e-189
CAB52472 ferredoxin-NADP+ reductase [Arabidopsis thaliana]16888e-186
XP_002327750 predicted protein [Populus trichocarpa]16351e-179

Swiss-Prot top hits (Blast detail)Scoree value
Q9FKW6 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic17171e-190
P10933 Ferredoxin--NADP reductase, leaf isozyme, chloroplastic15916e-176
P41346 Ferredoxin--NADP reductase, chloroplastic15692e-173
P41343 Ferredoxin--NADP reductase, chloroplastic15388e-170
O04977 Ferredoxin--NADP reductase, leaf-type isozyme, chloroplastic15333e-169

TrEMBL top hits (Blast detail)Scoree value
A9PJ48 Putative uncharacterized protein16357e-180
B9MXF5 Predicted protein16357e-180
A5BG49 Putative uncharacterized protein16052e-176
B9GZ04 Predicted protein15846e-174
Q9M4D2 Chloroplast ferredoxin-NADP+ oxidoreductase15712e-172

Arabidopsis top hits (Blast detail)Scoree value
AT5G66190.1 FNR1 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 1); NADPH dehydrogenase/ electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis/ electron transporter, transferring electrons within the noncyclic electron transp17232e-192
AT1G20020.1 FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding14123e-156
AT1G20020.3 FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding14088e-156
AT5G66190.2 FNR1 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 1); NADPH dehydrogenase/ electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis/ electron transporter, transferring electrons within the noncyclic electron transp12922e-142
AT1G20020.2 FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding9751e-105

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
151  10%
 
182  20%
 
83  30%
 
112  20%
 
191  10%
 
71  10%

Unigene MembersMember information