Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14101

FASTA Sequence
Unigene ID: UN14101Length: 1610  SNP
GCTTCAAAATTTTAATAATTTTATTATATATATTAAAGCACTCTTGCATATTGAGAATCATACAAAATTTACTACTCAGTAATGTG
TCACTCTCTCTGGAGATATCCACATCATTTATATGTCAAAAAAGTATAATAAATACAAGAGTGATATATCAAAACTTTTCCATCGC
AGTCTAATTAATCAAAGTGTCTTAATTAGATGGATGCTTGGTGGACAAGCGACTATAAAATTCAAGGACCCGATTTAGCGATCTCA
GTGCAAGCAGGTGGAATCATCTGTCCGGTGAGAACAGGCTTCATGTTAGCACAGGCCCCTACAGCTGGTCCTTCTGCACCTTTGTG
GACCAAGTTGATGTCAGCAAGAGCAACATTAGTGCAAGGCGTGCCTGAGCTGCAGATTAATTTCACAGCAATCTTTGTCGCTGATG
TGCCCTTAATGTTCTTGAAGGTCACGTCCGACAATTTCACCTTAGAAGGTACCCCAACTTTGCAGTCGGCATAAGGACAGTACTCT
TGGTCGATGAGAACGGGAGTGCTAACATTGTCCATTGTGATATCCTCAAAAATAATGTTGGAGGCAATACCAGGAGGAGATCCAGG
CCATGTCTTGATGCGAACACCATTCATGGTGTTCTTGATGAGGCATTTCCTCACTGTGACTCCTTTGACTGGTTGCTCATTAGGGT
ACCTTCCTAGACTCCCTACGGCAATGCCGTGTCCCGGTCCACATTCCACATTCTCAACAATGAGATTCTCAGTACCATCTCCTATG
GAAACACAGTCATCTCCTGTTTTAATCTTTGCCCCTAGTAAGTTCACGCCGATGGACCTTCCAATGTGGATACCATCAGTGTTGAG
ACTCTCCGGTGGTGCATCAATACCAATTTTCTCAAGAGTTACGTTCTTGCAGTTGAGAACGTTCATGTGGAAAAGTTTGCTGTTCG
TTGATGTTATGCCAATAATTTTGGAGTTTGTGAGACCCGTGAATCGTATGTTGATGGGGAGAGAGTTGCATTTTCCAGTTTTTGCG
CAGTCATTGGCCTTCCAAGCGAGGGAGCCTTGACCGTCAAAAATGGCTCCGTTTCCATTCAAAGTGAAATCAGCAAGATTTGTAAA
ATCAATCCATCCGCTGTTAGGCTTAGTGGCACCGACCGTAGCCGGAGCCTTCATATTGCCGTGCATTTCCAAAGTGACAGGACCCT
TGCACGGACCTAAGAACTCTATGTTGTTCACCAAATAATCACCCTTTGGCATTGTAATCGTGCTCGGTCCTGCTGCTTCACACGCT
GTTTTCCATACAGCCAAAAATGCCGCAGTGTCATCGGTTGTTCCGTCTCCTTTGGCTCCTGCTGCTTTAACGTCAAGTGCTCCACC
ACTTCCTGCGGGTCCTGTTGGTGCAGCTGCGCCGCTTCCTTTGGGTCCTGGATCAAGGGGTGCCCCGTTTGCTATTGTGTTCAAAA
TAGCCACTACTAGTACAAGAAGTACCGTCTTTGCTCTGCGCAAACCCACCATTTTTATTCTCTTTTATTTTGTCTTATTTAATACT
AGATCTTTATTTATTTTTTTTGTTTTTTTTGTTTTTTTTTTGTTTTTTTTGTTTTTGTTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ADJ68232 exo-polygalacturonase [Brassica rapa subsp. campestris]19551e-216
XP_002885005 polygalacturonase [Arabidopsis lyrata subsp. lyrata]17579e-194
XP_002862616 polygalacturonase [Arabidopsis lyrata subsp. lyrata]17561e-193
XP_002884670 exopolygalacturonase [Arabidopsis lyrata subsp. lyrata]17514e-193
NP_188020 exopolygalacturonase / galacturan 1,4-alpha-galacturonidase / pectinase [Arabidopsis thaliana]17471e-192

Swiss-Prot top hits (Blast detail)Scoree value
P49063 Exopolygalacturonase clone GBGA48317172e-190
Q39786 Polygalacturonase10692e-115
Q39766 Polygalacturonase10649e-115
P24548 Exopolygalacturonase (Fragment)10111e-108
Q6H9K0 Exopolygalacturonase (Fragment)10048e-108

TrEMBL top hits (Blast detail)Scoree value
Q9LVJ4 Polygalacturonase; pectinase17479e-193
O65401 Polygalacturonase17442e-192
Q39094 Exopolygalacturonase17381e-191
Q8W4P2 Polygalacturonase; pectinase17334e-191
B9DHZ7 AT3G14040 protein (Fragment)13769e-150

Arabidopsis top hits (Blast detail)Scoree value
AT3G14040.1 exopolygalacturonase / galacturan 1,4-alpha-galacturonidase / pectinase17484e-195
AT3G07850.1 exopolygalacturonase / galacturan 1,4-alpha-galacturonidase / pectinase17181e-191
AT5G48140.1 polygalacturonase, putative / pectinase, putative9634e-104
AT3G07840.1 polygalacturonase, putative / pectinase, putative9562e-103
AT3G07820.1 polygalacturonase 3 (PGA3) / pectinase9446e-102

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
102  6%
 
75  14%
 
97  20%
 
63  9%
 
129  26%
 
183  9%
 
86  17%

Unigene MembersMember information