Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14137

FASTA Sequence
Unigene ID: UN14137Length: 1838  SNP
GGAAAGAGGTGAACAAAAATGTCTATGTGGATCGTTCTAGCTTGCATGGTGACATCTTGGATCTTCGTGCACCGATGGGGACAGAG
GAATAAGAGAGGTCCCAAGACATGGCCTTTGGTCGGAGCAGCCATCGAGCAGTTGACCAATTTTGACCGAATGCACGATTGGCTCG
TTGAGTATCTTTACGACTCGAGAACCGTAGTGGTTCCCATGCCCTTCACCACTTATACATACATAGCAGATCCCATCAATGTAGAA
CACGTTCTCAAAACCAATTTCTCCAACTACCCAAAGGGAGAGACGTACCATTCGTATATGGAAGTTTTGTTGGGAGATGGGATCTT
CAATTCAGATGGAGAGCTTTGGAGGAAACAGAGGAAAACCGCGAGTTTTGAGTTTGCTTCCAAGAATCTCAGAGACTTCAGTACCG
TAGTGTTTAAAGAGTACAGCCTCAAGCTCTTCTCCATCCTTTGTCAAGCTTCTTTCAAAGACCAACAAGTAGACATGCAGGAATTG
TTGATGAGAATGACTCTAGACTCCATATGTAAAGTGGGATTTGGTGTGGAGATAGGAACATTAGCTCCAGAGTTACCAGAGAATCG
CTTTGCTAAGGCTTTTGATACTGCAAATATAATTGTAACACTTCGTTTCATAGACCCTCTTTGGAAGATGAAAAAGTACCTTAACA
TAGGCTCTGAGGCATTACTTGGAAAGAGCATAAAAGTCGTCGATGATTTCACCTATTCAATGATAAGAAGAAGGAAAGCAGAGATA
TTAGAGGCACAGAAATCTCCTTCCAACAACATCAAGATGAAGCATGATATACTCTCGAGGTTCATTGAGATCAGCGACGATCCTGA
CAGCAAATCAACTGAGAAAAGTCTAAGAGATATAGTCCTTAATTTTGTTATTGCTGGAAGAGATACAACAGCAACAACTCTCACTT
GGGCTATATACATGATAATGACGCATGAACATGTCGCCGAGAAGCTTTGCTCAGAGCTTAAAGAACTCGAAAGAGACAAGGCAGAA
GAGACTAACACACCGTTGTGTCATTACGATACAGAGGATTTCAAGTCCTTTAACGAGAGGGTAACACAGTTTGCAGGAATGCTAAA
TTATGATTCCTTAGGAAAGCTACACTACTTACACGCAGTGGTAACAGAAACACTTCGTCTCTACCCTGCGGTTCCTCAGGATCCAA
AAGGAGTGTTAGAAGATGATATATTACCTAATGGAACAAAGGTGAAAGCAGGAGGTATGGTAACATATGTTCCTTACTCGATGGGT
CGCATGGAATACAACTGGGGATCAGATGCAGCTACGTTTAAACCTGAAAGATGGCTTAAAGATGGGATGTTTCAGAACGCTTCCCC
ATTCAAGTTCACAGCATTTCAGGCTGGACCTAGGATATGCTTGGGAAAGGATTCAGCTTATCTACAAATGAAGATGGCAATGGCAA
TTCTTTGCAGATTCTATAGATTCCATTTGGTGCCAAATCACCCTGTCAAGTATCGGATGATGACTATCTTATCTATGGCGCATGGT
TTGAAAGTTACCGTCTCTAGACGTTCATAGACAGAAACAAAAAGAGAGAACAATAAAGGGAAAGTCTAATACAGTGTTGAATGATT
CAAGAAGATAAGATATACGAAACTTTATTAAACACTTTGTTCTTAGACTATCAAAGAAGAACAATTGTCCAAGTGAATACATAATG
TCAAATTTCATGTTCTAAAATTTGGTGAGTAGATAACTTCTTTTCAATAAAAATCTTAAGTTATGATTTTGCTAATAAATTAATTA
TTTTTGGTTATGAATAAGATTATGAGAATTAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002887239 oxygen binding protein [Arabidopsis lyrata subsp. lyrata]25275e-283
NP_177109 cytochrome P450, family 704, subfamily B, polypeptide 1 [Arabidopsis thaliana]25061e-280
BAC43393 unknown protein [Arabidopsis thaliana]22775e-254
ABK28457 unknown [Arabidopsis thaliana]22775e-254
XP_002522465 cytochrome P450, putative [Ricinus communis]22032e-245

Swiss-Prot top hits (Blast detail)Scoree value
Q50EK3 Cytochrome P450 704C111778e-128
Q9FMY1 Cytochrome P450 86B15381e-053
P98188 Cytochrome P450 94A25227e-052
O23066 Cytochrome P450 86A25138e-051
O81117 Cytochrome P450 94A14716e-046

TrEMBL top hits (Blast detail)Scoree value
Q9C788 Cytochrome P450, putative25061e-280
A0MEF2 Putative uncharacterized protein (Fragment)22774e-254
Q8GWJ5 Cytochrome P450 family protein22774e-254
B9S8Z6 Cytochrome P450, putative22031e-245
B2Z9X5 Cytochrome P45021044e-234

Arabidopsis top hits (Blast detail)Scoree value
AT1G69500.1 electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding25074e-283
AT3G26125.1 CYP86C2; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding7871e-083
AT2G45510.1 CYP704A2; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding6193e-064
AT2G44890.1 CYP704A1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding5721e-058
AT3G56630.1 CYP94D2; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding5333e-054

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  6%
 
182  11%
 
112  11%
 
94  22%
 
86  33%
 
62  11%
 
121  6%

Unigene MembersMember information