Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14186

FASTA Sequence
Unigene ID: UN14186Length: 1344  SNP
GGGAACAGGGGAAAAGGAAAAAAAAAGGAGATGAAGAGGACAAGAGCGCTCTTGTGTCTCATTCCCATCCTCCTTACCGCCGCCGC
AGATTCCACGGAAGATACGGCAGTGCGTCTCAAAATATCACATCGGGACACTCTCTTCCCAACATCATCCCACCGCATTGAAGACA
TTATCAGCGAGGACCAGAAGCGTCACAGCCTCATAACTCGAAAACGAAAGACCAACGGAGGAGGAGCAAAACTGCCATTGAGATCA
GGTTCCGACTATGGAGCGGCGCAGTACTTTGCTGATGTCAAGGTTGGAACGCCGGCGAAGAGGTTCAGGGTGGTGGTGGATACAGG
GAGCGAGCTGACGTGGGTGAACTGCAGGTTCCGAGGGAAAGGAAAAGGGAAAGAGAAAGAGAAGAAACGTCGAGTGTTCAGAGCAG
AAGAGTCTTCGAGTTTCAGACAAGTTGGATGTTTGACTCAGACTTGTAAAGCTGATCTCATGAATCTCTTCTCCCTCAGTAATTGC
CCTACTCCTTCAACTCCATGCTCCTACGATTATAGATACGCGGACGGGTCATCAGCACAAGGAGTATTCGCAAAGGAGACATTCAC
AGTTGATCTCACCAACGGTCGTGTAGCTAGACTCCGTGGCCTCCTCATCGGTTGCAGCAGCTCTTTCGATGGAGATAGCTTCCAAG
GAGCCGATGGAGTTCTTGGTCTAGCCTTGAGTGATTACTCCTTCACTTCCAAAGCCACTAACCTTTTCGGTGGTAAATTCTCATAC
TGCCTCGTTGACCATCGCTCCCACAAAAACGTCTCCAGCTATCTCATCTTCGGCTCTACCACCAAACCAACCGCCACACGGACCAC
CCCTCTTGATCTCAACCTCATTCCTCCCTTCTACGCCATCAACATCATTGGGATCTCCCTCGGCGATGACATGCTTGATATCCCCT
CGCAAGTATGGGACGCAACAAACGGTGGTGGGACAATCTTGGACTCTGGAACCAGCCTAACGTTATTGGCTGACGCCGCGTACAAG
CCGGTGGTTTCGGGGCTTGAGCGTTACCTTGTGGGGCTGAAGAGAGTTAAACCAGAAGGAGTACCGATAGAGTATTGTTTTGATGT
CACGTCAGGGTTCAACGAGAGCAAGCTGCCGCAGTTGATGTTTCATTTCGACGGTGGTGCACGTTTTGAGCCGCATCGGAGAAGCT
ACCTAGTAGATGCTGCGCATGGAGTGAAGTGTTTAGGGTTTGTGTCGGCGGGAACGCCGCTACTAATGTGGTTGGGACATATGCAC
AGATTATTTGTGGGAGTTTGATGTGTGGCCTCACTTTGTCTTTTGCTCTTCTAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002882786 hypothetical protein ARALYDRAFT_478632 [Arabidopsis lyrata subsp. lyrata]16734e-184
NP_187876 aspartyl protease family protein [Arabidopsis thaliana]16019e-176
AAL49921 unknown protein [Arabidopsis thaliana]15902e-174
CAN65806 hypothetical protein VITISV_015630 [Vitis vinifera]9825e-104
XP_002265771 PREDICTED: hypothetical protein [Vitis vinifera]9744e-103

Swiss-Prot top hits (Blast detail)Scoree value
Q9S9K4 Aspartic proteinase-like protein 22968e-026

TrEMBL top hits (Blast detail)Scoree value
Q9LTW4 Chloroplast nucleoid DNA binding protein-like16016e-176
Q8VYM5 Putative uncharacterized protein At3g1270015901e-174
A5BLS9 Putative uncharacterized protein9824e-104
C0HEE2 Putative uncharacterized protein7583e-078
B9RXC6 Aspartic proteinase Asp1, putative7503e-077

Arabidopsis top hits (Blast detail)Scoree value
AT3G12700.1 aspartyl protease family protein16013e-178
AT3G12700.2 aspartyl protease family protein5978e-062
AT3G25700.1 chloroplast nucleoid DNA-binding protein-related4841e-048
AT3G59080.1 aspartyl protease family protein4411e-043
AT2G42980.1 aspartyl protease family protein4132e-040

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  13%
 
111  13%
 
101  13%
 
92  25%
 
192  25%
 
81  13%

Unigene MembersMember information