Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14192

FASTA Sequence
Unigene ID: UN14192Length: 1327  SNP
TTTTTGATATTTTTTTTCTACCTCAGCCATAGATATTAACTGAGAGTACAGTTTCTTCAGAAAGAGTTTGGTCCTCCTCTTCGTCT
TCCCTCTGCAGTAGGGATTGTCTTTCAGGAAAAGATCGAAACTTTATTAGATTTCCTGAAAGATGGGTAACGCTCTTGGATATCTC
TACGGAAAATGCTGCAAACCCACCACGGACGACGACTCTCTCGGTCCTCACGGCGTCTCCACCGTCGGTCTTTCAGCTCTCGCTCA
CGATCTCTTCAACTTCGAGATCACTTCCCAAGTTCCTGAAGGACTTGGGAGGTACGTTGTGTCATCAAGAAAAGCTCAAGCAAACT
GGTATAGAAAAATACTTGAGGCATGGAAGCAAGCAAAACCTCCACCACAGACAGCAGAGGATGCTTCTAGGCTTGTTATTGAGATC
TTGAAAAGGCATCAGAAAGCAGATGTTGAGGGGCTTTTGTCTTTCTATGGACTCCCTTTGCCTCACACTCTCGTTGAGCTCTCTAC
TGAAGCTCCTCCTGTATCTTTACCCGAAGGAGTTCTTTTCGAGTTTCAAACCCTCCCGGTGGATCCAAAAGCTGTGGCAGATGGAG
ACACCATCACAGTCTACGTCAGTAGTTCAGACCCGGTTGTGTCATCTTCTGTTCCAAGGGAAGTGAATGTTGCAGCGGTTAAAAGA
GCAAAGGCGAGAGAGAGGAAAGATTACACAAAAGCAGACGCGCTTCACCAGAAGATCATTGATTCTGGTTACAGAGTGCTAAACAT
TCAGAATGAAGAAGTGCTTGCTCGCAAGTTCAGAATCAGACTAAGGGGAATAGATGCACCAGAAAGCCAGATGCCGTTTGGGAAAG
AGGCACAAGAAGAGCTGCTTAAGATTGTTCAATGGAAAAGCTTGAAGGTGTTAGTTTATGGAGAAGATCGGTATGGGAGGTGTGTT
GGAGATTTATACTGCAATGGAGTTTTTGTTCAGGAGGCAATGCTAAAGAAAGGTCTTGCTTGGCATTATATAGCTTATGACAAGCG
CATTGTTCTTGCAAAGTGGGAAAAGGAAGCAAGGCAGAAGCGTATTGGCTTGTGGGCTTCTTCGAATCCAGAAAAGCCATGGGACT
GGAGAAAGAATAGGCGTGAGCAAAACAACTGATTAAACTGAAATCCGAGTTTAAGACAGTTGAGATTTTATGATTATTGAAGTTTT
TTTTTCTGATTTGGACTTATCTGATTCTATTGTAAGATGTTTAAAAATGGTAAACTTATGTATAAATGGTGCTTACATTGATCCTA
CGTACGATGGAACATAATAATAAAACATCACAGACCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_973649 Ca(2+)-dependent nuclease-like protein [Arabidopsis thaliana]15401e-168
XP_002879868 hypothetical protein ARALYDRAFT_483096 [Arabidopsis lyrata subsp. lyrata]14952e-163
XP_002311254 predicted protein [Populus trichocarpa]13142e-142
XP_002520814 hypothetical protein RCOM_0688330 [Ricinus communis]13042e-141
AAX21543 Ca(2+)-dependent DNase [Populus tomentosa]13024e-141

Swiss-Prot top hits (Blast detail)Scoree value
Q39635 Uncharacterized 38.1 kDa protein11686e-127
Q7BSX4 Uncharacterized endonuclease2196e-017
Q99342 Uncharacterized endonuclease2196e-017
Q57519 Uncharacterized endonuclease HI_12961982e-014
P29769 Micrococcal nuclease1292e-006

TrEMBL top hits (Blast detail)Scoree value
Q3EBI8 Putative uncharacterized protein At2g40410.215407e-169
B9HHW7 Predicted protein13141e-142
B9S495 Putative uncharacterized protein13042e-141
A1KYZ0 Ca(2+)-dependent DNase13023e-141
B9HYJ1 Predicted protein12996e-141

Arabidopsis top hits (Blast detail)Scoree value
AT2G40410.2 Ca(2+)-dependent nuclease, putative15404e-171
AT3G56170.1 CAN (CA-2+ DEPENDENT NUCLEASE); nuclease12492e-137
AT2G40410.1 Ca(2+)-dependent nuclease, putative10101e-109

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
91  4%
 
74  16%
 
83  12%
 
123  12%
 
102  8%
 
118  32%
 
64  16%

Unigene MembersMember information