Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14641

FASTA Sequence
Unigene ID: UN14641Length: 1560  SNP
GGAGATAAGCTCAGGACGGTGTTCGTCTTCCTCGGAGAGTGCCTGAAGCTGGTGGTGATGGACAACGAGCTCGGGAGCCTGATGAC
AGCCTTGGAAGGGAAGTACGTGGAGCCAGGTCCGGGAGGCGACCCCATCAGAAACCCTAAGGTGCTACCGACAGGTAAAAACATTC
ACGCGTGACCCTCAGGCTGTCCCCACGACGGCGGCGATGGCGAGCGCCAAGATCGTGGTGGACAGGTTGGTGGAGAGGCAGAGGAT
GGAGAACGAAGGGAAGTATCCGGAGACGATCGCGCTTGTGCTTTGGGGAACTGATAATATCAAGACGTATGGGGAGTCTCTCGGAC
AGGTGCTTTGGATGATTGGTGCTAGACCGGTTGCTGATGGTCTTGGGAGAGTGAACCGGGTTGAGCCTGTGAGCTTGGAAGAGCTT
GGAAGGCCGAGGATTGATGTCGTTGTTAACTGCTCAGGAGTCTTCCGTGATCTGTTTATTAATCAGATGAATCTTCTTGACAGAGC
AATCAAGATGGTAGCTGAGCTAGACGAGCCAGTTGAGATGAACTACGTGAGGAAACACGCCATGGAGCAAGCAGCAACGCTCGGCG
TTGATATCAGAGAGGCAGCTACAAGAGTTTTCTCAAACGCTTCGGGGTCATACTCGGCAAACATCAGTCTCGCTGTTGAGAACTCT
TCATGGAACGACGAGCAACAGCTTCAGGACATGTACTTGAGCCGCAAATCGTTTGCGTTTGACAGCGATGCTCCTGGAGCAGGGAT
GGCTGAGAAGAAGGAGGTCTTTCAGATGGCTCTTATGACTGCAGAAGTCACGTTTCAGAACCTCGATTCTTCCGAGATTTCGTTGA
CCGACGTGAGCCATTACTTTGACTCTGACCCGACAAACTTGGTTCAGAGTTTGAGGAAAGACAAGAAGAAGCCTAGCGCTTACATT
GCTGATACAACAACCGCAAACGCACAGGTGAGGTCACTGTCTGAGACAGTGAGGCTGGACGCAAGAACAAAGCTGCTGAACCCAAA
GTGGTACGAAGGAATGATGTCAAGCGGATACGAAGGTGTTCGTGAGATAGAGAAGAGACTGACCAACACTGTGGGATGGAGTGCAA
CCTCAGGTCAAGTAGACAACTGGGTCTACGAAGAGGCCAACACGACTTTCATCAAAGACGAGGAGATGCTTAACCGTCTCATGAAC
ACTAATCCAAACTCCTTCAGGAAGATGATCCAGACGTTCTTGGAAGCCAATGGTCGTGGCTACTGGGAGACTTCGGAGGACAACAT
CGAGAAGCTCAAGGACTTGTACTCTCAGGTCGAAGACAAGATTGAAGGGATCGATCGATAGATAAACAATGTGAAGCATATTTTTT
AAAGTAAATGGAAACAAACTGCATTGATGTTTTATTTTTCAAACAATGACATCATCTCTATGTGAATAAGAGAATGTTTTTGCTGA
CATTTTCTGACTTTATATGAATGTTGTGGAGCTTTTAATTCTAAGCCTAAGAGGCAGTATATGATGTTCTTTTTCACTTGGAGCAA
CAGCTTTAGTCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_196867 magnesium chelatase subunit H [Arabidopsis thaliana]18877e-209
AAL79577 AT5g13630/MSH12_9 [Arabidopsis thaliana]18877e-209
BAH20376 AT5G13630 [Arabidopsis thaliana]18877e-209
BAH20377 AT5G13630 [Arabidopsis thaliana]18877e-209
XP_002873621 hypothetical protein ARALYDRAFT_909315 [Arabidopsis lyrata subsp. lyrata]18877e-209

Swiss-Prot top hits (Blast detail)Scoree value
Q9RFD5 Magnesium-chelatase subunit H7726e-081
O50314 Magnesium-chelatase subunit H7539e-079
P26162 Magnesium-chelatase subunit H7342e-076
Q58836 Uncharacterized protein MJ14417036e-073
Q58318 Uncharacterized protein MJ09086732e-069

TrEMBL top hits (Blast detail)Scoree value
B9DI09 AT5G13630 protein (Fragment)18875e-209
B9DI10 AT5G13630 protein (Fragment)18875e-209
Q8RY14 AT5g13630/MSH12_918875e-209
Q9FNB0 AT5g13630/MSH12_918875e-209
Q39049 Magnesium chelatase subunit18812e-208

Arabidopsis top hits (Blast detail)Scoree value
AT5G13630.1 GUN5 (GENOMES UNCOUPLED 5); magnesium chelatase18882e-211
AT5G13630.2 GUN5 (GENOMES UNCOUPLED 5); magnesium chelatase12752e-140

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
106  15%
 
123  8%
 
82  5%
 
610  26%
 
93  8%
 
1111  28%
 
74  10%

Unigene MembersMember information