Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14643

FASTA Sequence
Unigene ID: UN14643Length: 1580 SSRSNP
ATATTAACTAAATTAATATTACACAAATATGATTACAAGAAAAAACACAACTATAAATATTTCTTAAAAAGTTAAAATAAAAAATA
TACCCGTCTTTTAAAAAGGCGGGTTAGTAATAGTATATATATATATATATATATATATATATATATATATAAACCGTGTAAATCTA
AGCTGAATTTTGGTTTATTATTTGAGTAAATGATCGACATATTGATTCACTTCCTGAACAGCCCACACTACGTGGTAAGAGTTACA
ATGATCGATCTTTTATTATAGAGGGAAACTCACTCGAGAAAGATGAAAAAAGAAGTTGAAAACGAAAACATCACAAATTCAATTTC
TTAGATGCAATTTATAGGGACTCAATAGAACTCGTAACCGCGGCTTGCTGACGAGCTAGAGTCGCTGGCTTGGACGGTGGCTGACG
TTGTAGGTAACCAAACTTCCCTCATAGGTTCATCGACTGGGTAAACAACGAGCTCGCGAACATTCATTGGTTGGATCACATTTGGA
TCGGCTCCAAAAAGAAGATGACCAAAACTCTCTTGTGCCTTCTCGGTATTGTGACGCCCATCGAAGAATAAGTAAGATCGTTGGTA
CTCACATAGCCTGGAGTGCACGTTAGGTAAACCGCAACCGTAAGCATTGTGTGTCCCAACACCGCAGCATGATGCATTTGTCACGA
AAAACCTGTAGTTGAAGCCGCTCTGCGTCCTACGAAGAATGACATTGTAGAAATCGAAGACGGTAAATTGGAAACCAGGAGTTGTT
CGGGCCATTTCGTTCAACATCGGTCCGATTTTTTCGTTGTGTTGTTTAGCCAAATTGTTGAGAACTTCGTGGCATTGATCCATTCC
TGTTTTGTAATCTTGTCTGACTATAGGTAAGCAACCTAATGGTGCTAAGGTTTGGATCACAAATTTACTAGCTCCTGATGAATACA
ACAAGCCGATATCATTCTTTAACTTGTTGGTCACCGAAGTGACGAAAGCTTGTTGAGCAGATGCATCGGCGCTCGGGTTGTTCTTG
GTGAAATTCAAGTAGTCGTTAGCACCAACGTATATCATAAACACTGACTTCTTGATGAAGTCATCATCCCAATTTGCTGCTTTCAT
TTGATTAAATTTCCGCACTTGTTGATTTAGAGTCAAAGATTCAACCGGAGCTCCGAGAAGAGTAGCATCAGCAACGGCGAAACTAG
CTCCACGTGAGACATTGACGTTCGGTTTAAGCGCCGCCGGGATTGGGATTGGTATCCCCATGAATTTTGCGACGAAGTCAGGAGCG
ATGAAACCGTCGGAGAATTTGCCATTAGGATCATCTCTGGATTTACCGTACGGCCAGAAACCTTGGGGAACGTTTGCTGTGGTGAG
AGTCTGTTTGTTTCCTACGTCGAAGTTGGAGTCACCGAACGTGAACAAAGCCACCGCCGGGATATTTTGACCGGAGACGGTGAGCG
GGTTGTGTAGCAGCGTCAATACCAAAACTACCCCTAGAACACTCGTTAAAATATACTGGCCTGCCATTGAGTGAGAGAGGAGGAAA
GTAAGAGAGGATGTTTGCTTGTGTGCTTTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002894473 hypothetical protein ARALYDRAFT_474528 [Arabidopsis lyrata subsp. lyrata]17246e-190
NP_175802 GDSL esterase/lipase [Arabidopsis thaliana]16889e-186
AAM67268 myrosinase-associated protein, putative [Arabidopsis thaliana]16816e-185
AAM64922 myrosinase-associated protein, putative [Arabidopsis thaliana]16791e-184
NP_564647 GDSL esterase/lipase [Arabidopsis thaliana]16772e-184

Swiss-Prot top hits (Blast detail)Scoree value
Q1H583 GDSL esterase/lipase At1g5400016884e-187
Q8W4H8 GDSL esterase/lipase At1g5401016777e-186
Q9C5N8 GDSL esterase/lipase At1g5402014473e-159
Q9LJG3 GDSL esterase/lipase ESM113506e-148
P86276 GDSL esterase/lipase9009e-096

TrEMBL top hits (Blast detail)Scoree value
P93063 Myrosinase-associated protein14063e-153
P93064 Myrosinase-associated protein13973e-152
C1KH68 Epithiospecifier modifier13696e-149
C1KH67 Epithiospecifier modifier13642e-148
Q39308 Myrosinase-associated protein12819e-139

Arabidopsis top hits (Blast detail)Scoree value
AT1G54000.1 myrosinase-associated protein, putative16892e-188
AT1G54010.1 myrosinase-associated protein, putative16803e-187
AT1G54020.2 myrosinase-associated protein, putative14473e-160
AT3G14210.1 ESM1 (epithiospecifier modifier 1); carboxylesterase/ hydrolase, acting on ester bonds13505e-149
AT1G54020.1 myrosinase-associated protein, putative11159e-122

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
2024  53%
 
87  16%
 
124  9%
 
103  7%
 
112  4%
 
94  9%
 
71  2%

Unigene MembersMember information