Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14704

FASTA Sequence
Unigene ID: UN14704Length: 1022 SSRSNP
GGGAACTCATGTTTCTGTGTTCCCAATTGTAGAACAACAACACACATCTTGACATAAGAACTCTCTTGTTCTGTTTCTTATCCTGT
TTCAAGAATTCGTTTTTCTTGATTTCTGTTGGAAGATGAATCTGAATATAAAGCACATGGGCAAAATGATCTATCAAGATTCAAGT
AGGACAGAAGAAGAAGAAGACCTTGTTGAAGGAGTTTCAAGATCAATGTTAGAAGCTGAAACATTCTCCGGGGAAGAAAAAGATTT
GTCATCTTGTTCATTATCTTCCATGTGTTCATCTGATTTAACAGAGGAGGATGATGATGCTTCTTCATCTTTTTCAAATGGACCTC
TTGAAGATCTCTCTGACCTCATGTTACACCTCCCAATCAAGAGGGGATTGTCAAAGTTTTATGAAGGAAAATCTCAATCATTCACA
TCACTAGCAAATGTTAAAAGTCTTGAAGATCTTATGAAGAGAGGTTTTAAAAATACAAGTAATAAAGCAAGAAGAAAGGCATGTAA
GAGCACCGGAGGAATAATAGATCAAAGCTACAAAAGGGTTTATAGCCCAAAAGCTACAATCTCCAAGAAAGCCAACAAAACACCTT
CTTTTGTTCTCTCTTCTCTAGCCAGGAAAAAACTTTAGATCCGAGAGGAACATTAGTCTTTCTTTTATTTTTATTTTTTAAATCCT
TTTTACGATTCACCAAATCGGTTTCAGTAACATAACCAAAAATAAAACATGTTCACCTTAAATCTTAAGCCTGTAAGAAAGATATT
CCCAGTGTCTTAAACGTGTAGAAAAGTTAAATATTTGTACACCCTTTTTTCGGCCCCTGGCTCTGTTTAGTTGAATGTATCAAAGC
TTGTTGTTTCACATAGCAAGAGACAGCTTGTCCGTGTTCCATATCGATAACCTGAGAAGGTTTATGTAATGGATCAGACCATTGAT
TGGTATGGCTATGCAACCATTGATTGATACGGCTATGCAAAAAATAAAAAGAAAACAGATGAAAACTGTATATGGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002866155 predicted protein [Arabidopsis lyrata subsp. lyrata]5943e-059
NP_200466 oxidative stress 3 [Arabidopsis thaliana]5901e-058
XP_002280262 PREDICTED: hypothetical protein [Vitis vinifera]3122e-026
CBI27985 unnamed protein product [Vitis vinifera]3122e-026
ACU20700 unknown [Glycine max]2898e-024

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9LVB9 Emb|CAB83157.15907e-059
C6TFU8 Putative uncharacterized protein2895e-024
C6SYZ5 Putative uncharacterized protein2762e-022
C6T2P9 Putative uncharacterized protein2644e-021
A5BBL4 Putative uncharacterized protein2511e-019

Arabidopsis top hits (Blast detail)Scoree value
AT5G56550.1 OXS3 (OXIDATIVE STRESS 3)5913e-061
AT4G26288.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: OXS3 (OXIDATIVE STRESS 3) (TAIR:AT5G56550.1); Has 272 Blast hits to 170 proteins in 34 species: Archae - 0; Bacteria - 10; Metazoa - 90; Fungi - 21; Plants - 81; Viruses - 2; Other Eukaryotes - 68 (source: NCBI BLink).2705e-024
AT3G43850.1 unknown protein1406e-009
AT5G24890.1 unknown protein1308e-008
AT4G26290.1 unknown protein1253e-007

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
68  22%
 
77  19%
 
112  6%
 
1011  31%
 
92  6%
 
86  17%

Unigene MembersMember information