Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14707

FASTA Sequence
Unigene ID: UN14707Length: 3678  SNP
GCTGCTTGTCGAGAGTTTGGAAAATCTCATCTTGAGATATTTAGCTTTCGACCACGGGAAAAGAAGCTGAAATAGTAGGAGTTTAC
CTTATAGCAGGACACTCGCCCGTTGACAACTCTTTCTTAGGTTACTAATCGGTGACTTGCTTCGCCCAGGGGAATTCTATACTGTT
TCATTCCTGTTGGTTCAGGCCTCCTCTTCCATCCCGTGTTCTACTTACATTCAAATTGAGTGCTTTTTTTTTGTCTCCACTTGAGT
CTTAGTTACTGGTAGCAATTTCATGACATTGCCCCACTGTAACTGGACAGCCAAATCGTACATCCTAAATATTATCCCGTACCTGA
ACGAATCATCCATGTTCGCAGGTCGGTAATATGTACGGATAAAGATCGGCACATCCATAAAGACTTCAAGCTCTATACTGGCACTA
AGCCTTAGCATACAATTCCATCTTTGATACTCCAGATAAAGCTTCATCCACCCATGGTACAGAGTGTATTCATTGAATACTTCCAT
ACCTGGATAGGCAACACCTCACTAGGAGGAAGTCTCGACTGAAAGAAGAGGAGGAAGGATAGGATCTTTCGGAGTATAGTGCTCCA
AAAGAGTCCAAATTATCCTACCCTCCACATGAGGGTGCAATGGAGCACCTAACACCGTGGATAACCCAATACGCAAGCTACTTTTA
TTTGAGTGCGCATGGATCCTCATCACCATCAGCCTCTTCATAAAACGTTTGTGTCGAAGAGACGAAGGTTCCCGCGGTTCAGAATG
AGCTTCTGCGCCGGTAAGCCCCCGAATCTTACTCAGTGGGCATCATAAAGAGCTCTAAAGGGGTGTGAGAGGACCGGAAAATAATG
AGTCAAGCCTGAAAAGAAAGTCGAACCGCGAAGGCAAGTATCCTCGCCCCCGCGATGGGAACTTTCAATAAAGCACAGTAGAGTGC
TTTACCTACCAGAGGTATCTATAGAATGAAAGAATCATTTTATGCTTCCTTGGCCATGTACAACATGGATTAGCATTATGTCATTC
CTACAATTCCTACAAGTGATCCACCTTCCAGTATTTGAAGGAGAGGACTTCGATATATTATATAATATGTTTCTTTCCATTCCTCG
TGAGCCACTTATTTCTCCGAAACAAGAGATCAAAGTGATTTTCCTCCTTTTTCCCAATAAGTCGACGGCCTTACACCATTGGGATA
CTTCGAATAAACTAGCATACATATAGGATACACCAGTGCTAAAACCTTTTCTCAAGAGATCTTCCAAACTGTTGGGGTCCTTGCTC
TGGATGGTCTTCCCCCGGTGTGAAAGCAGTTGGTTCCGTAGTTTTAGAATTCTGCTGATCCCAAGTACTCCATCTCCATCATTGCA
TATGAAAATATAGAAAGTAAAGAAGAAAAGGCATAACCAGAAGAATTGTGAAAAATAAGTGAATTTATCCAGTTGAGGCATGATTA
GATTAATTGATTTCAACAAAATGATTCCCTCCAGACAGCTTCACTCCGTCAAGCCTCTAGGAGTAGTGAAGAACTATAGAAAGTTG
TGGTTGGTTGTTGACCAACAAAAGCATGGGAGAAAACCAAGAAAAAGGGGGCATAGAGATTTCTTCTCTTATGAGATTGATAGTTT
GATCGCGGGGGCGGCCCGGCAGGCTAGCGATCAGAAAAGAAAATCGATTCTATATACGTTATGGTATGGAAAAAGATCTGACTTCG
TTAGAAGAAGATGAGCTGCCTAGATCTTTGTATGTCCAGGTCTCGGTAATTGAAGAAAGAATGCCCAGGTGATTAAGCCCGGTAAG
ACCCCGTGATAAGACATCTTCCGCAATACAAAATAACAACGGGAGATAAAGGATCCCCCTGTCTCACACCGCCTAACATGAGAAAT
ATCCTTTTGGAGAACCATTAACCAAGACAGAGAGCTTGGCAGCGTCGAGGTGCTAAAGCACCTCTCCTTTGCTGTTCGAGTAAACA
AGAAATGCTCGAGTTACTAAACACCCCCTAGGGGGCCCCTCTCTGATAAGGAAAAAAACGAAAAAATCTCAAATTTATGAAAAATC
TGGTTCGATGGCTGTTCTCCACAAACCACAAGGATATAGGGACTCTCTATTTCATTTTCGGTGCCATTGCTGGAGTGATGGGCACA
TGCTTCTCAGTATTAATTCGGATGGAATTAGCACGACCCGGCGATCAAATTCTTGGTGGGAATCATCAACTTTATAATGTTTTAAT
AACAGCTCATGCTTTTTTAATGATCTTTTTTATGGTTATGCCGGCGATGATAGGTGGATTTGGTAATTGGTTTGTTCCGATTCTGA
TAGGTGCACCTGACATGGCATTTCCACGATTAAATAATATTTCATTCTGGTTGTTGCCACCAAGTCTCTTGCTCCTATTAAGCTCA
GCCTTAGTAGAAGTAGGTAGCGGCACTGGGTGGACGGTCTATCCGCCCTTAAGTGGTATTACCAGTCATTCTGGAGGAGCAGTTGA
TTTAGCAATTTTTAGTCTTCATCTATCTGGTGTTTCATCCATTTTAGGTTCTATCAATTTTATAACAACTATCTTCAACATGCGTG
GACCTGGAATGACTATGCATAGATTACCCCTATTTGTGTGGTCCGTTCTAGTGACAGCATTCCTACTTTTATTATCACTCCCGGTA
CTGGCAGGGGCAATTACCATGTTATTAACCGATCGAAACTTTAATACAACCTTTTTTGATCCCGCTGGAGGGGGAGACCCAATTTT
ATACCAGCATCTCTTTTGGTTCTTCGGTCATCCAGAGGTGTATATTCTCATTCTGCCTGGATTCGGTATCATAAGTCATATCGTTT
CGACTTTTTCGGGAAAACCGGTCTTCGGGTATCTAGGCATGGTTTATGCCATGATCAGTATTGGTGTCTTAGGATTTCTTGTTTGG
GCTCATCATATGTTTACTGTGGGCTTAGACGTAGATACCCGTGCCTACTTCACCGCAGCTACCATGATCATAGCTGTCCCCACTGG
AATCAAAATCTTTAGTTGGATCGCTACCATGTGGGGGGGTTCGATACAATACAAAACACCCATGTTATTTGCTGTAGGATTTATCT
TTTTGTTCACCATAGGAGGACTCACTGGAATAGTCCTGGCAAATTCAGGGCTAGACATTGCTCTACATGATACTTATTATGTGGTT
GCACATTTCCATTATGTACTTTCTATGGGAGCCGTTTTTGCTTTATTTGCAGGATTTTACTATTGGGTGGGTAAAATCTTTGGTCG
GACATACCCTGAAACTTTAGGTCAAATCCATTTTTGGATCACTTTTTTCGGGGTTAATTTGACCTTCTTTCCTATGCATTTCTTAG
GGCTTTCAGGTATGCCACGTCGTATTCCAGATTATCCAGATGCTTACGCTGGATGGAATGCCCTTTCCAGTTTTGGCTCTTATATA
TCCGTAGTTGGGATTTGTTGTTTCTTCGTGGTCGTAACAATCACTTTAAGCAGTGGAAATAACAAAAGATGTGCTCCAAGTCCTTG
GGCTCTTGAACTTAATTCAACTACACTGGAATGGATGGTACAAAGTCCTCCTGCTTTTCATACTTTTGGAGAACTTCCAGCTATCA
AGGAGACGAAAAGCTATGTGAAGTAAAAGAAGAAAAGGTCGCCGACTGCTACTAAGAACCTAACAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_085587 cytochrome c oxidase subunit 1 [Arabidopsis thaliana]28000.0
AAP58356 cytoplasmic male sterility-associated cytochrome oxidase subunit I [Brassica juncea]27886e-313
YP_003587346 cytochrome c oxidase subunit 1 [Cucurbita pepo]27876e-313
AAW55635 cytochrome oxidase subunit I [Brassica juncea]27851e-312
YP_003587228 cytochrome c oxidase subunit 1 [Citrullus lanatus]27842e-312

Swiss-Prot top hits (Blast detail)Scoree value
P60620 Cytochrome c oxidase subunit 128000.0
P60621 Cytochrome c oxidase subunit 128000.0
P24794 Cytochrome c oxidase subunit 127614e-311
P14578 Cytochrome c oxidase subunit 127041e-304
P05502 Cytochrome c oxidase subunit 126952e-303

TrEMBL top hits (Blast detail)Scoree value
Q6WAV9 Cytochrome c oxidase subunit 128000.0
Q6YSM3 Cytochrome c oxidase subunit 128000.0
Q7YFE1 Cytochrome c oxidase subunit 127884e-313
D5I3H0 Cytochrome c oxidase subunit 127874e-313
Q5I7E5 Cytochrome c oxidase subunit 127859e-313

Arabidopsis top hits (Blast detail)Scoree value
ATMG01360.1 cytochrome c oxidase subunit 128010.0
AT2G07707.1 hydrogen ion transmembrane transporter/ hydrolase, acting on acid anhydrides, catalyzing transmembrane movement of substances8383e-089
ATMG00480.1 Encodes subunit 8 of the mitochondrial F(O) ATP synthase complex.8383e-089
AT2G07708.1 unknown protein4315e-042
ATMG00500.1 hypothetical protein4315e-042

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
817  15%
 
615  14%
 
1130  27%
 
181  1%
 
1010  9%
 
921  19%
 
1214  13%
 
72  2%

Unigene MembersMember information