Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14710

FASTA Sequence
Unigene ID: UN14710Length: 1285  SNP
AAATGATATTTACGCTAGCAAAACCAAAAAATATATATTACGTAACTTATTAGTTTAGGCAATGCGTTTTAGATTTCTCTCCAAAC
AGAATCCGCAGAACAGAAATCCGACCAAGTGCCAGAATAAACTCAACTTTTGTCTGTTTTACCAAAACACAAAAGCAAATTTTAAC
AAAACCTCAATGCCTAGATGGCAATACCTCCATCAATGGTGAATGACTGTCCGGTAATGTAACTGGCTGCAGGACTGAGAGCCAAG
AATTCTACCAAGCCAGCCACATCTTCCGGTTGTCCATACCGTCCTAATGGGATTGTTCCCAAGATTTTCTTTTCCATGTCTTCTCC
AAGCTTGGCAGTCATGTCAGATGCAATGAATCCAGGACAAACCACATTGACATTAATATTCCTGCTCGCACCCTCTCTGGCGGCAG
TCTTGGAGAACCCAATAACTCCAGCTTTAGCAGCAGCATAGTTTGCTTGGCCAATGTTACCAATGAGACCAACAACTGACGCTATG
TTGATGATTCTTCCCTTTCTCTTCTTCATCATGATCTTTGTTGCTGCCTGGGTACAGAGAAACACTCCAGTGAGATTCAAATCAAT
CACTTCATCCCATTGGGACTTCTTCATGCGAATCAACAAGGTATCCCGAGTGATTCCTGCATTGTTAACGACGACATCAATGGTTC
CCCATGCATCAATAGCGGTTTTCATCATGGCTTCCACATCAGCTTCTTTTGAGACATCACCCCCAAAAGTAATAGCCTGGCCACCA
TATGCTTCAATCTGTTTAGAAACTTCCTCAGCCTCCTTTGCTGACCTAGCATAGTTCACCAACACCTTGCAGCCGGCTTTGCCCAA
GGAAAGAGCAATAGCTTTACCAATCCCTCTAGAGGCACCAGTGACAACGACCACAGGAGACTCCACTTTCGGAACAGCTTCACCCG
TCGCTTGCTCAACAGCTGTTGTCGCTTGAGCCTTCACAACGGTGGATGTTGCAAAGGACTGTCCCGATCCGCATCGGAGCATTCCG
TAACGAGGCATTGCGGACTGAAGAGGAGACCATTGACGGACCTGGCAGATCTCGTGGATGCCGAGGTTCCTGGCGGATCTCAAGGA
GGTGAGCTTTGTTGCTGCTGCTGCGACGGTGGTGGTTGCCATCGAAGGGAGAATACGGTGAGAGCGGAGGAGGTAGAGAAGGGAGT
CCGAACTAGCGAACCTCGTAAAGATCGACACTGTGTAAGAGAGAGAGGGCGAGACGAGAGTGTTGGAATATTTAATTGGCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
Q93X62 RecName: Full=3-oxoacyl-[acyl-carrier-protein] reductase 1, chloroplastic; AltName: Full=3-ketoacyl-acyl carrier protein reductase 1; AltName: Full=Beta-keto acyl-carrier protein reductase 1; Flags: Precursor14915e-163
Q949M3 RecName: Full=3-oxoacyl-[acyl-carrier-protein] reductase 3, chloroplastic; AltName: Full=3-ketoacyl-acyl carrier protein reductase 3; Flags: Precursor14361e-156
Q93X67 RecName: Full=3-oxoacyl-[acyl-carrier-protein] reductase 2, chloroplastic; AltName: Full=3-ketoacyl-acyl carrier protein reductase 2; Flags: Precursor14172e-154
Q93X68 RecName: Full=3-oxoacyl-[acyl-carrier-protein] reductase 5, chloroplastic; AltName: Full=3-ketoacyl-acyl carrier protein reductase 5; Flags: Precursor13761e-149
XP_002893453 chloroplast 3-oxoacyl-(acyl-carrier protein) reductase [Arabidopsis lyrata subsp. lyrata]13491e-146

Swiss-Prot top hits (Blast detail)Scoree value
Q93X62 3-oxoacyl-[acyl-carrier-protein] reductase 1, chloroplastic14912e-164
Q949M3 3-oxoacyl-[acyl-carrier-protein] reductase 3, chloroplastic14365e-158
Q93X67 3-oxoacyl-[acyl-carrier-protein] reductase 2, chloroplastic14177e-156
Q93X68 3-oxoacyl-[acyl-carrier-protein] reductase 5, chloroplastic (Fragment)13764e-151
P33207 3-oxoacyl-[acyl-carrier-protein] reductase, chloroplastic13102e-143

TrEMBL top hits (Blast detail)Scoree value
B9RMM7 Ketoacyl-ACP Reductase (KAR)11893e-128
B9HTB3 Predicted protein11572e-124
B9HL98 Predicted protein (Fragment)11302e-121
C6TC08 Putative uncharacterized protein11194e-120
B4FTC8 Putative uncharacterized protein10926e-117

Arabidopsis top hits (Blast detail)Scoree value
AT1G24360.1 3-oxoacyl-(acyl-carrier protein) reductase, chloroplast / 3-ketoacyl-acyl carrier protein reductase13111e-144
AT1G62610.1 short-chain dehydrogenase/reductase (SDR) family protein3163e-029
AT1G62610.2 short-chain dehydrogenase/reductase (SDR) family protein3163e-029
AT1G62610.3 short-chain dehydrogenase/reductase (SDR) family protein3163e-029
AT1G63380.1 binding / catalytic/ oxidoreductase3073e-028

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
192  8%
 
93  12%
 
86  23%
 
114  15%
 
103  12%
 
71  4%
 
61  4%
 
182  8%
 
201  4%
 
213  12%

Unigene MembersMember information