Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14711

FASTA Sequence
Unigene ID: UN14711Length: 1568 SSR 
AGTCCGAAAAGTCACATTTCTACGATCCCAAACATAACAGCGATGAGAAGAACAATACAGACACAAAGACATTTAGACTACTAACG
TCCCATATCACAATAATTTTAGCCAAAATGTCAAAATGGATAATTTAGATTATTGAAAAAAACATAGCTTCTTAAAAACAAAGACG
ACCAGAGACAACAATAGAAAGATCAATGGAAAATATCTTCTTTTGTTCTTCCACCATATATCATCTTCCTCATAACTTATTGTTGT
ACCAGAACACACCTTTCTTCTCACCTTGCCTGTCAGGCTCTACATAGATACACTCCTTCGCCTCCCTCCACATCGCCTTAAACACT
GGCGTCCCATCGAACTGGTAATAATCCCCCAGTATCGGTTTTATCGCCTTGGTAGCTTCCATCGCGTGGTAGTGCGGCATCGTGGA
AAACAGGTGATGCGCCACGTGCGTGTCCGTGATATTGTGGAAGACCTTGTTCAAGATTCCGTAGTCTCTGTCCACGGTAGCCAAGG
CTCCCCTCAACCAATCCCACTCCGAGGAGTCGTAGTGAGGCAGAGAAGGGTGCGTGTGCTGCAAGTAAGTGATCAAGACTAAGAAC
CCGTTGACAATCAGAAGCGGAACCCCGTAGAGGCAGACCATCGAGGCCAGACCCTGAGCAGCGGCGTAACGGTAGAGACCGTAGCA
GACGGCGAGGATACCGGCGTCGGAGACGTATATCTGGAGGCGTTCGCGGTCGTTGTAGATGGGAGCGTTGGGGTGGAAATGGCAAG
CAAAGCCAACGTCGTAAGGCCTGCCCGAGACGTTGAAGGCCAAGTACAAGGGCCAGCCGAGGGTGAACTGGACGGTTAGCATGACG
GTGCGTCCGAGAGGGTTGTTGAGGTACTTGCCGTACCACTTGATGTCAGACTTCTTCTTGGGGACGAAGACTTCGTCTCTCTCGAG
GGAGCCGGTGTTGGAATGATGGCGTCGGTGACTGTACTTCCAGGAGAAGTAAGGGACGAGGAGGAAAGAGTGGAAGATGAGACCGA
CGGTGTCGTCTAGCCACTGGTAGTCGCTGAAGGCGTGGTGGCCGCACTCGTGAGCTATGACCCAGACGCCGGTTAGGACGCAGCCT
TGGCAGGCCCAGTAGAGAGGCCAGGCGAAGTAGGAGAGAGGGTGAGGGAGGAGAGGGAAGTAAGTGGTGGCGACGTAGTAGAAGCA
GGAGGCTATGATGATGTCCCAGATGAGGTAGGAGAATGAGCGAGGGATGGAGCGTTTGAAACAGTGCGGTGGGATCGCTTTCTTGA
GCTGTCCTACAGTGAAGGGAGGTGTCTCGCAGGGTACGCGTTTGAGGGTTTCGGTTTCTGACTTCTTGGGAGAAGGAGATACCTGC
ATTCTTCCACCTGCACCCATTTTGTTTTCTTCAGCTGACGTAGGGGGGGATAGAGATTTAACGTTAATAACGATGAACCCTACGAA
GAAGCTCCTCCGCAAACTCTCTCTCTACCTTCTCTCTCTCCTTTCTATCTCTCTCTCTCTTTGGTAATGAAACTCTCTCTCTGGTT
TCTGGTCAGAAGGAAAATCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAD19742 delta-12 desaturase [Brassica carinata]20921e-232
ACN53522 fatty acid desaturase 2 [Brassica juncea]20921e-232
ACP39502 delta-12 oleate desaturase [Brassica napus]20921e-232
CAD30827 fatty acid desaturase 2 [Brassica rapa]20875e-232
ACP39504 delta-12 oleate desaturase [Brassica napus]20875e-232

Swiss-Prot top hits (Blast detail)Scoree value
Q39287 Omega-6 fatty acid desaturase, endoplasmic reticulum20738e-232
P46313 Omega-6 fatty acid desaturase, endoplasmic reticulum19421e-216
P48631 Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 216713e-185
P48630 Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 115362e-169
O81931 Delta(12) fatty acid dehydrogenase12753e-139

TrEMBL top hits (Blast detail)Scoree value
C0LEJ5 Fatty acid desaturase 220928e-233
C3W518 Delta-12 oleate desaturase20928e-233
Q9ZPI2 Delta-12 desaturase20928e-233
C3W519 Delta-12 oleate desaturase20873e-232
C3W520 Delta-12 oleate desaturase20873e-232

Arabidopsis top hits (Blast detail)Scoree value
AT3G12120.1 FAD2 (FATTY ACID DESATURASE 2); delta12-fatty acid dehydrogenase/ omega-6 fatty acid desaturase19439e-218
AT3G12120.2 FAD2 (FATTY ACID DESATURASE 2); delta12-fatty acid dehydrogenase/ omega-6 fatty acid desaturase19439e-218
AT2G29980.1 FAD3 (FATTY ACID DESATURASE 3); omega-3 fatty acid desaturase6069e-063
AT5G05580.1 FAD8 (FATTY ACID DESATURASE 8); omega-3 fatty acid desaturase5531e-056
AT3G11170.1 FAD7 (FATTY ACID DESATURASE 7); omega-3 fatty acid desaturase5468e-056

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1810  23%
 
207  16%
 
103  7%
 
2120  45%
 
193  7%
 
71  2%

Unigene MembersMember information