Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14753

FASTA Sequence
Unigene ID: UN14753Length: 1603 SSR 
GGACTTTGAAATTTAGTGAAATCCTAACGCTCTGGCCCCATCCTTGCCTCCTCTATCATCTCCCTAGAACCACTCACTACTCTCTC
TCTCTCTCCCTCACTTCTATCAATGGCGTCTTCCCAGATCTCATTCTCTCTGGTGTGCGTTGCTCTCATCTTTTTCTCTATTCCTC
TAAACGTCTCCTCCATTGGCATCAACTACGGTCAGGTTGCCAACAACCTTCCTCCCCCAAAGAACGTCATCCCTCTCCTCAAGTCT
GTAGGCGCCACCAAAGTCAAGCTCTATGACGCCGATCCACAAGCCCTCCGTGCCTTCTCCGGCTCCGGCTTCGACCTCACTGTCTC
CCTCGGCAACGAGTACCTTGCCCAGATGAAAGACACCGACAAAGCCCGTGATTGGGTGAAGCAAAACGTCCAAGCTTACCTCCCAG
CAACCAAGATCGTTGCCATCGTGGTAGGCAACGAAGTCCTCACCTCCAACCAGTCAGACCTTTCCGCGGCGCTCTTCCCGGCGATG
CAGAGCATCCACGGTGCTCTTGTCGACTGTGGCCTCAACAAGCAGATCTTCGTGACTACAGCTCACTCCCTAGCCATCCTCGACGT
ATCCTACCCTCCCTCCGCCACATCCTTCAGACACGACCTCCTGGCAACCCTCACTCCCATCTTGGACTTCCACGTCAAGACTGGCT
CCCCCATCCTCATCAACGCCTACCCTTTCTTCGCCTACGAGACTAACCCCAAACACATCTCTCTCGACTTCGTCCTCTTCCAGCCA
AACCAGGGCTTCACCGATCCTGGCTCCAATTTCCACTACGACAACATGCTCTTCGCCCAGGTTGACGCCGTCTACCACGCCCTTGA
CGCCGTCGGCATCACCTACAAGAAAGTCCCCATCGTTGTCTCTGAGACCGGATGGCCCTCCAACGGCGACCCGCAGGAGGTTGGAG
CCAACTGCGACAATGCACGCAAGTACAATGGAAACCTTATCAAGATGATGATGAGCAAGAAGATGAGGACTCCCATTCGACCAGAC
TGCGATCTCACCATCTTCGTCTTTGCTCTCTTCAATGAGAACATGAAGCCTGGCCCCACCTCCGAGAGGAACTACGGCCTCTTCAA
CCCTGACGGAACTCCCGTTTACTCCCTCGGGATCAAGACCTCCTCCTCCTCAGGTGGTGGTAGTAGTAGCGGCAGCAAAAACTCCA
CCGGTGGTGGTAGTAGCAGCAGTGGCGGTAGCACTGGTGGATCACCAGGTGGTGGTGGCGGCGGCGGCGGCATCTACACGCCAGAG
AACCCTTCACCGGATTACATGTCCATTTCCTCCGCAATGGGAAAAGGCAGATTCGTTGAGTGCGTGTTCTTCTTCCTCTTGCTTTG
CATCATCAAGCTTCGGCTGTAAAAGCTTCACCCCACTAGATCTCGGCTTTGTACCTCTATTTGGGTTGATGACGGAAATTATCCCC
GAATTTTATTTTATTTAATTAGTTTATGTTGGTGTATGGTCGGAAACCTATTTTCTGAATGGAGTCAATGGACCGTGGATTTAGAA
AACTTACCATCTTTGTTGTGCCCACCCCTCCTCTCTTCAACTTCTATTTCTTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_199025 glucan endo-1,3-beta-glucosidase 10 [Arabidopsis thaliana]18941e-209
XP_002868559 glycosyl hydrolase family 17 protein [Arabidopsis lyrata subsp. lyrata]18796e-208
NP_974868 glucan endo-1,3-beta-glucosidase 10 [Arabidopsis thaliana]18106e-200
XP_002518930 Glucan endo-1,3-beta-glucosidase precursor, putative [Ricinus communis]12301e-132
ADW08745 1,3-beta-D-glucanase GH17_65 [Populus tremula x Populus tremuloides]12183e-131

Swiss-Prot top hits (Blast detail)Scoree value
Q9FHX5 Glucan endo-1,3-beta-glucosidase 1018945e-211
Q8L868 Glucan endo-1,3-beta-glucosidase 1112143e-132
Q9ZQG9 Glucan endo-1,3-beta-glucosidase 149681e-103
Q9M069 Glucan endo-1,3-beta-glucosidase 77431e-077
Q8VYE5 Glucan endo-1,3-beta-glucosidase 126841e-070

TrEMBL top hits (Blast detail)Scoree value
B9RYW1 Glucan endo-1,3-beta-glucosidase, putative12308e-133
B9I0S4 Predicted protein11993e-129
B9GIT6 Predicted protein (Fragment)11922e-128
C6TH22 Putative uncharacterized protein10032e-106
D6PS66 AT5G42100-like protein (Fragment)9986e-106

Arabidopsis top hits (Blast detail)Scoree value
AT5G42100.1 ATBG_PAP; glucan endo-1,3-beta-D-glucosidase/ hydrolase, hydrolyzing O-glycosyl compounds18991e-212
AT5G42100.2 ATBG_PAP; glucan endo-1,3-beta-D-glucosidase/ hydrolase, hydrolyzing O-glycosyl compounds18102e-202
AT1G32860.1 glycosyl hydrolase family 17 protein12143e-133
AT2G27500.1 glycosyl hydrolase family 17 protein9681e-104
AT2G27500.2 glycosyl hydrolase family 17 protein9681e-104

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
111  11%
 
182  22%
 
212  22%
 
191  11%
 
61  11%
 
82  22%

Unigene MembersMember information