Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14764

FASTA Sequence
Unigene ID: UN14764Length: 1541  SNP
CATTGTACAATGGCGACCTTCACACTCAAATCCTTCACCGGACTCCGACAATCCTCACCAGATCAGACCAGCTTCATCTCCCATGT
CCCGTCGTCACTCTCTCTCCCCCAGCGCCGGACCCCTCTCCGAGTCTCCGCCGCAAGATCCTCCCCCAATCTCGCCAACCGCAAAC
TCCGCGTCGCCGTCATCGGCGGAGGTCCGGCGGGAGGAGCCGCCGCCGAGACTCTCGCTCAGGGAGGCATCGAGACGATCCTCATC
GAGCGCAAGATGGACAACTGCAAGCCCTGCGGCGGCGCCATCCCTCTCTGCATGGTCGGGGAATTCAACTTGCCGCTCGACATCAT
CGACCGGAGAGTCACCAAGATGAAGATGATCTCTCCTTCCAACATCGCCGTCGACATCGGCCGTACGCTCAAGGAGCACGAGTACA
TAGGTATGGTGAGGAGAGAGGTTCTTGACCAGTACCTTAGGGAGAGAGCGGAGAAGAGTGGAGCTACTGTGATCAACGGTCTCTTC
TTGAAGATGGATCTGCCGGAGAACTGGGACACGCCGTACGTGTTGCATTACACGGAGTACGACGGGAAAACGGGAGCTACGGGGCA
GAAGAAAACGATGGAGGTTGACGCCGTTATCGGAGCTGACGGGGCTAATTCGAGAGTTGCGAAGTCCATCGGCGCCGGAGATTACG
ACTATGCCATCGCGTTTCAGGAGAGAATTAGAATCCCAGATGATAAGATGACATACTACGAGGATCTAGCTGAGATGTACGTCGGA
GATGACGTGTCACCCGATTTCTACGGATGGGTTTTCCCGAAATGCGACCACGTAGCTGTCGGAACAGGCACTGTGACTCACAAAGG
TGACATCAAGAAGTTCCAGCTCGCGACAAGAAACAGAGCCAAGGACAAGATTCTAGGAGGAAAGATCATCCGCGTCGAGGCTCATC
CTATCCCGGAACACCCGCGGCCACGTAGGCTATCCAAGCGTGTGGCTCTTGTGGGTGATGCTGCAGGGTACGTGACTAAATGCTCT
GGTGAAGGGATCTATTTCGCTGCAAAGAGTGGAAGAATGTGTGCTGAAGCCATTGTTGAAGGCTCGCAGAATGGTAAGAAGATGAT
TGATGAGAGTGACTTGAGGAAGTACTTGGAGAAATGGGACAAGACATACTTGCCTACGTACAGGGTTCTTGATGTGTTGCAGAAAG
TGTTTTACAGATCTAATCCGGCTAGAGAAGCGTTTGTGGAGATGTGTAGCGATGAGTATGTTCAGAAGATGACGTTCGATAGTTAT
CTGTACAAGAGGGTTGCACCGGGTAGTCCATTGGAGGATTTGAAGTTGGCTGTGAACACCATTGGGAGTGTGTTTAGAGCTAATGC
TTTGAGGAGAGAGATTGAGAAGCTAAATGTTTAAGACAAATAAGAAGAGATTATTTCTTGTCTTTTTTAATTTTAAAAGTATGTTT
ATGTTATCTGTTTATTGAATGGTCAGTCAAAAAGCATTTGGCTTTACAATCCAATTTCTCACTAAAACATTATTTCACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABI63587 geranylgeranyl reductase [Brassica rapa subsp. pekinensis]23213e-259
CAA74372 geranylgeranyl reductase [Arabidopsis thaliana]22972e-256
NP_177587 geranylgeranyl diphosphate reductase [Arabidopsis thaliana]22953e-256
AAN31803 putative geranylgeranyl reductase [Arabidopsis thaliana]22901e-255
XP_002887543 hypothetical protein ARALYDRAFT_476582 [Arabidopsis lyrata subsp. lyrata]22882e-255

Swiss-Prot top hits (Blast detail)Scoree value
Q9CA67 Geranylgeranyl diphosphate reductase, chloroplastic22951e-257
Q9ZS34 Geranylgeranyl diphosphate reductase, chloroplastic19823e-221
Q6Z2T6 Geranylgeranyl diphosphate reductase, chloroplastic17611e-195
Q55087 Geranylgeranyl diphosphate reductase14232e-156
P26172 Geranylgeranyl diphosphate reductase3693e-034

TrEMBL top hits (Blast detail)Scoree value
Q09JZ1 Geranylgeranyl reductase23212e-259
A9PH25 Predicted protein20282e-225
B7X936 Geranylgeranyl reductase20085e-223
B9RLY0 Geranylgeranyl hydrogenase, putative20041e-222
C8CLK4 Geranyl geranyl reductase20013e-222

Arabidopsis top hits (Blast detail)Scoree value
AT1G74470.1 geranylgeranyl reductase22961e-258

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  4%
 
212  8%
 
193  12%
 
181  4%
 
123  12%
 
84  15%
 
66  23%
 
96  23%

Unigene MembersMember information