Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14771

FASTA Sequence
Unigene ID: UN14771Length: 1407  SNP
GGGCCTTTGAGGTGAAGTGCCTAAAACGTCGTCCTTACATTTGATAAAACGACACCGTTTCAGAAACTCGATCAGACAAGAAGTGA
CGTCTGACGGAGAAATCCAAAACAGAAGCGAAAACAATGACGAGAGCCCTTCTCCTCAGAGCTCTGACGAAGAAGAAGAAGCTCGT
CCCCCCCAACGCTCATCGATCCATCTCCATCATCACCAACCTCTCTCGATGCATTAGCACTCTGATTCTAGCGGAACATGAGAGCG
GTTCCATCAAACCTCAGACAGTGAGTACAGTAGTTGCAGCGAACCAATTGGGTGAGAGCTCTTCAGTTTCTTTGCTATTAGCTGGT
TCCGGCTCTTCTCTTCAAGAAGCTGCTTCTCAAGCTGCCTCTTGTCATCCTTCTGTTTCCGAGGTACTTGTTGCTGATTCAGATAG
ATTTGAGTACCCTTTAGCTGAACCTTGGGCAAAATTAGTTGACTTTGTTCGGCAACAAAGAGGAGATTACTCTCACATCCTTGCTT
CCTCTAGCTCATTTGGCAAAAACATACTACCCCGAGTTGCGGCTCTTTTGGATGTCTCTCCTGTTACTGATGTTGTCAAAATCTTA
GGACCCAACGAGTTTATCAGGCCTATATATGCGGGAAACGCCTTGTGTAGAGTTCGTTATACTGGTCCTGGTCCTTGTGTTTTGAC
TATTAGAACTACATCTTTTCCTGTTACCCCAGTAACTGAGTCAAAGAAAGCTACTATCTCTCAGATTGATCTCTCAAATTTCAAAG
AAGAATTTGTGAGTAGATCCAGATACGTGGGGCAATCAACTCAGGATACAGAACGGCCTGATCTTGGAAGTGCACGTGTTGTGGTT
ACAGGTGGAAGGGCGTTAAAGAGCGTTGAGAACTTTAAATTGATCGAAAATCTTGCAGAGAAACTTGGCGGAGCAGTTGGTGCGAC
TCGTGCTGCGGTTGATGCTGGATATGTTCCTAATGATCTTCAGGTGGGGCAAACGGGGAAAATAGTAGCACCAGAGTTATACATGG
CGTTTGGTGTTTCAGGAGCTATTCAACACTTAGCTGGAATTAAGGATTTTAAGGTGATTGTGGCAGTTAATAAAGACGCAGATGCA
CCTATTTTTCAGGTAGCTGATTATGGACTTGTTGGAGATCTTTTTGAGGTGATACCAGAGTTGCTGGAGAAGCTTCCGGAAAAGAA
ATGAGAAACTCTTAAGCTCTCAGGTTGCAGACCATAGTAAAGTAGTGTACATAGCAAAATTGTAATAAAAAACGGTCTGAATAATC
ATTGTCATAATCTCTATTTCACTTTTGATTCTCTGCAACGAATATGATACAAAAAAATAAAACCATTTGAAAAGTGTTTAACTTTC
TAAATGAATTCTATTTATATAAATTTTCTTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002894284 etfalpha [Arabidopsis lyrata subsp. lyrata]15938e-175
NP_175507 Electron transfer flavoprotein subunit alpha [Arabidopsis thaliana]15874e-174
XP_002281637 PREDICTED: hypothetical protein [Vitis vinifera]12542e-135
XP_002316984 predicted protein [Populus trichocarpa]12471e-134
XP_002522865 electron transport oxidoreductase, putative [Ricinus communis]12066e-130

Swiss-Prot top hits (Blast detail)Scoree value
Q9C6I6 Electron transfer flavoprotein subunit alpha, mitochondrial15872e-175
A2XNR6 Electron transfer flavoprotein subunit alpha, mitochondrial11283e-122
Q75LJ3 Electron transfer flavoprotein subunit alpha, mitochondrial11283e-122
Q93615 Probable electron transfer flavoprotein subunit alpha, mitochondrial7538e-079
Q8HXY0 Electron transfer flavoprotein subunit alpha, mitochondrial7412e-077

TrEMBL top hits (Blast detail)Scoree value
B9I0B5 Predicted protein (Fragment)12477e-135
B9SA46 Electron transport oxidoreductase, putative12064e-130
B7FIC7 Putative uncharacterized protein11876e-128
B7E6V7 cDNA clone:001-039-D01, full insert sequence11284e-121
B4F8E3 Putative uncharacterized protein11241e-120

Arabidopsis top hits (Blast detail)Scoree value
AT1G50940.1 ETFALPHA (electron transfer flavoprotein alpha); FAD binding / electron carrier15881e-176

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
126  26%
 
84  17%
 
93  13%
 
193  13%
 
116  26%
 
71  4%

Unigene MembersMember information