Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14814

FASTA Sequence
Unigene ID: UN14814Length: 546  SNP
TTTCTCTCTGCTTCCGTGGTCTCCTCGTTCGTGTTGCTTCTCTCTCGCTCGTCTACGCGATTTGACTCGAGGATTTGTGCTAGGTT
GAAATGGCAGGACACAGGGTTGCGCATGCTACACTGAAAGGCCCGAGTGTGGTGAAGGAGTTAGTTATCGGTTTGGCACTCGGTTT
AGCTGCGGGTGGTCTCTGGAAGATGCACCACTGGAACGAGCAGAGGAAAACCAGAGCTTTCTATGACTTGCTTGAGAGGGGCGAGA
TCAGCGTTGTCCACCCTGAAGAATGAGTAGTGAATTCAACACCTACCAATCTCTCAATCTCTACTTTTTTTTATGTTATTGTATGG
TTTCTTGACAACTTGGATGAAGTGCCTGAGAAAAAGGGGTTGCTTACGTAATAAAACAACAAATCTGAGACCGGATTTTTGGGGAT
TTGTTAAACATAATATTTGTTTTCCGGAAGATACATGTATGCTACTGTGCTCCATTGTTCAATTTCAGACAGCTTTCTTGACTTTT
CTTTAAATAAACAGGTGCTTTCACTAAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880298 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata]3133e-027
XP_002866426 hypothetical protein ARALYDRAFT_496289 [Arabidopsis lyrata subsp. lyrata]3116e-027
NP_182260 putative cytochrome c oxidase subunit 5C-1 [Arabidopsis thaliana]3081e-026
XP_002862722 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata]3081e-026
Q9LZQ0 RecName: Full=Cytochrome c oxidase subunit 5C-2; AltName: Full=Cytochrome c oxidase polypeptide Vc-23044e-026

Swiss-Prot top hits (Blast detail)Scoree value
O22912 Probable cytochrome c oxidase subunit 5C-13087e-028
Q9LZQ0 Cytochrome c oxidase subunit 5C-23042e-027
Q9FLK2 Probable cytochrome c oxidase subunit 5C-33033e-027
Q8VY39 Cytochrome c oxidase subunit 5C-22836e-025
Q9SXX7 Cytochrome c oxidase subunit 5C2773e-024

TrEMBL top hits (Blast detail)Scoree value
Q2HIR0 At5g613103034e-026
A1YMW4 Cytochrome-c oxidase2972e-025
B9RNE3 Cytochrome c oxidase polypeptide Vc, putative2873e-024
D6BR49 Cytochrome c oxidase polypeptide Vc2837e-024
C6T2P2 Putative uncharacterized protein2783e-023

Arabidopsis top hits (Blast detail)Scoree value
AT2G47380.1 cytochrome c oxidase subunit Vc family protein / COX5C family protein3095e-029
AT5G61310.1 cytochrome c oxidase subunit Vc, putative / COX5C, putative3042e-028
AT5G61310.2 cytochrome c oxidase subunit Vc, putative / COX5C, putative3042e-028
AT5G61310.3 cytochrome c oxidase subunit Vc, putative / COX5C, putative3042e-028
AT5G61310.4 cytochrome c oxidase subunit Vc, putative / COX5C, putative3042e-028

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
128  50%
 
101  6%
 
112  13%
 
82  13%
 
202  13%
 
191  6%

Unigene MembersMember information