Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14825

FASTA Sequence
Unigene ID: UN14825Length: 1397 SSRSNP
ACTACACCCGCACAAAATCTAGTTAAACATTAAGGGAGCAGGGACAAAACTACTAGAATGAAAACAGAGTTACATCTTTTAATGAA
AAACGTAAGTTGACATAATTTTTGATCATTTACAGAGACGTCAGAGGATAGTATCATTTTTGTTTTTGTTTTTGTTTCTTCTCGTT
TCTCCATCAGACAAAAACTACTTACACTAGAGAGACAGACATACATGTCAGAGGGAAGAAAGAAGCAGTAAAGATGATATCTGATG
AAACATTGTGAGGTAGACTCACCAATCTCTCAGCATTCACATCTCTTTGCTAATGTTTTCTTTACTCCTCTCACAATCTTACCGAA
CCATACCAAGTTCATGATACCAAGCGCAGCTGGTACCCCAAATACCAGAGCGTATCCGAAGATGTGCATCCTCATGACCTGGTTGT
AGTGCAGATAGACATGATAAAACATGTATATGAAAAGAAGAATTCTAGCAACCAGCCAAGCCAAGAAGATGAAGACGCCATTGACA
ACATAAGCCATTGACTTCTTCATACCAGCTGTGTCCAGGTACCATCTCAAGTTGATCTCTGGGGTTGTAATCTCGGAGATGAGGAC
CATGTATGTATACAACTGTCCTTCCCCAGAAAACAAGGAGTAGGCAACAGCTACTCCCGAGAGCGAGTGATGCACAATATACTCAA
GTCCACCCAAAGAAGGATATTTCCAGAAGATCATGCCGAGATCAGCAATGAAGTAACCAATGGATAACCCTAAACCAAGAGAGGAA
AGACGTGAGCTCCGGAAGACAACAAGATCATTGTGCCACCTATCAGAAAAGAGATCGGACCAGAAGACAAAGTAGAGCGACATTGC
CGAGATAAAGATAGCATGAACCGTCGAGATACCACGGTTGTTCCATTCGATTCGTTGAATCTTGGTGAGGATGATATAGGTCTTGG
AATGGGAGTTGCTGATGAAGTGACAAAGATCATAGACCACTTTGCAGAGGAACATGCCGGTGAGAATAGAAGTGTAAGGAATAAAA
GGATCAGCCAAGAGATAGTTGTTAACCAAATGCTGGGCTTGATGATGATATGCCTTTATGGCACCAATCGTTTGCAAAGAAGTCGA
CGACATTGCAGATTATTATTATTATTTTATTTGATTTTTGATTTACCGATTCCTCATCTCATCATTCGCCAATCAATCTCGAGACG
CTAATAATCTCGTCTAGGGGAAAATATCTCGGAGAAAATGGACGCAAAGGAAGAGAGGATCCGCGGCGAGAAAAGTGAGAGAGAGA
GAGAGAGTGAGAGAGAAAGGAAGCAGCCAAGCTTTAGCTTTAATCAATGTGAAATGTGAAGGAGAAGAAAAGAAGAAGATGAGAAG
AACACAAAAGACTCGTCTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_564377 TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein [Arabidopsis thaliana]14333e-156
XP_002893848 hypothetical protein ARALYDRAFT_473644 [Arabidopsis lyrata subsp. lyrata]14306e-156
BAH19941 AT1G31300 [Arabidopsis thaliana]14191e-154
XP_002263050 PREDICTED: hypothetical protein [Vitis vinifera]10784e-115
CBI29075 unnamed protein product [Vitis vinifera]10767e-115

Swiss-Prot top hits (Blast detail)Scoree value
Q6PGS5 Transmembrane protein 56-B2341e-018
Q8CGF5 Transmembrane protein 562251e-017
Q5XIY2 Transmembrane protein 56-B2081e-015
Q6GLX2 Transmembrane protein 56-A1865e-013
Q6P4N1 Transmembrane protein 561821e-012

TrEMBL top hits (Blast detail)Scoree value
Q93Z82 At1g31300/T19E23_1214332e-156
B9DGS4 AT1G31300 protein14198e-155
Q8GSI6 At4g1964510291e-109
B9ICG7 Predicted protein10263e-109
B9NA48 Predicted protein10201e-108

Arabidopsis top hits (Blast detail)Scoree value
AT1G31300.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19645.2); Has 478 Blast hits to 478 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 98; Plants - 80; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).14348e-159
AT1G31300.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19645.2); Has 478 Blast hits to 478 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 98; Plants - 80; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).14348e-159
AT4G19645.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 401 Blast hits to 401 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 186; Fungi - 102; Plants - 84; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).10297e-112
AT4G19645.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 401 Blast hits to 401 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 186; Fungi - 102; Plants - 84; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).10297e-112
AT4G10360.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 453 Blast hits to 451 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 225; Fungi - 97; Plants - 91; Viruses - 3; Other Eukaryotes - 37 (source: NCBI BLink).6703e-070

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1210  59%
 
101  6%
 
112  12%
 
82  12%
 
191  6%
 
211  6%

Unigene MembersMember information