Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14847

FASTA Sequence
Unigene ID: UN14847Length: 826 SSR 
ATCATCGAACAGATCTGATCGCCCCGAGTCGTCGTCTCTTCTCTCTCGATTCCAACAAAAAAAACAATGGCTGAGGCAACAACAGC
TTTGAGGAAGCCTGTGTTCACCAAGGTTAATGAGCTGAGACCAGGAACCAATGGTCACTCTCTGAACGTGAAAGTTGTCAGCACGA
AGATGGTGATGCAGAGAGGTGGTGGAGGTCGTCCCAGTGGTCCTCAGGCTCGTCAGATGCGGATTGCTGAGTGTCTTGTTGGTGAT
GAGACTGGCATCATTATCTTTACTGCCAGAAACGATCAAGTGGATTTGATGAAAGAAGGCAAGGTTGTGACCCTGCGCAACGCCAA
GATCGACATGTACAAGGGATCTATGAGGCTTGCAGTTGATAGATGGGGACGCGTTGAAGTCGCTGAGGAGGATGCCACAGGCATCA
CCGTCAAGGAAGATAACAATCTTTCCCTCATCGAGTATGAGCTTGTGAACGTTGAAGCTTGATTTAGTTTCAGCCAACTGAAAGAA
AGCAGAGTGACTCACAAGACTTATATTCTCTAGTTGTAGAAGCAATAGCATCTCTCTCTCTCTAGTCTCTACTCTGCTTTGAGTTT
TTGCTTATCAGAATTTGCAGGTGGGGTTTGTTGCTGGTTTGAGTCTTTTATGTATTATCTGGCTTGCCTCTGATTTACCCTTTCTC
GTTTTAAATATAAGGTTGCTGGATCATTCTCATGTTCTAGTTTTGGTTTCTCTCTGTGTTGTCTTTGGATGCTATAAATAAACGTA
TAAAGACGATATATGTAACGACGAGAACAATAAGTTCTATTTTATTCCTACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002892583 predicted protein [Arabidopsis lyrata subsp. lyrata]6363e-064
NP_849633 replication factor A1 [Arabidopsis thaliana]6292e-063
NP_563874 replication factor A1 [Arabidopsis thaliana]6248e-063
AAZ32857 unknown [Medicago sativa]5281e-051
XP_002525380 conserved hypothetical protein [Ricinus communis]5252e-051

Swiss-Prot top hits (Blast detail)Scoree value
O49453 Uncharacterized protein At4g284404084e-039

TrEMBL top hits (Blast detail)Scoree value
Q9XIJ0 T10O24.246291e-063
Q93W05 At1g10590/F20B24_16245e-063
Q45NM5 Putative uncharacterized protein (Fragment)5287e-052
B9SHB1 Putative uncharacterized protein5252e-051
A5C3Z4 Putative uncharacterized protein5181e-050

Arabidopsis top hits (Blast detail)Scoree value
AT1G10590.1 DNA-binding protein-related6307e-066
AT1G10590.3 DNA-binding protein-related6307e-066
AT1G10590.2 DNA-binding protein-related6307e-066
AT1G23750.1 DNA-binding protein-related5178e-053
AT2G33845.1 DNA-binding protein-related4229e-042

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
83  13%
 
1212  52%
 
103  13%
 
112  9%
 
91  4%
 
202  9%

Unigene MembersMember information