Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14915

FASTA Sequence
Unigene ID: UN14915Length: 1157 SSRSNP
GGACACACCGCTACTCAATTCAGACAAACTCCATAGCTAATCTAGAGAGAGAGAGAAAATATGTCGAAAGAAGTGAGTGAAGAGGG
ACAAACAACACACAGCCATGGAAAAGACTACGTGGATCCTCCACCAGCTCCCCTTCTCGACATGGGAGAGCTCAAGTCTTGGTCTT
TCTACAGAGCTCTCATCGCCGAGTTCATCGCCACCCTCCTCTTCCTCTACGTCACCATAGCCACAGTCATCGGCCACAAGAAACAA
ACCGGTCCTTGTGACGGCGTTGGTTTACTCGGTATCGCTTGGGCCTTCGGTGGTATGATCTTCGTCCTCGTCTACTGCACCGCCGG
CATCTCTGGTGGTCACATTAACCCAGCTGTGACTTTTGGTCTGTTCTTGGCACGTAAGGTGTCTTTGGTGAGAGCTGTTGGTTACA
TGATAGCCCAGTGTCTTGGAGCCATTTGTGGTGTGGGTTTCGTGAAAGCTTTCATGAAGACTCCTTACAACACTCTCGGTGGCGGA
GCTAACACTGTCGCCCCTGGTTACAGTACAGGAACTGCCCTCGGAGCTGAGATCATCGGAACTTTCGTCCTCGTTTACACCGTCTT
CTCTGCTACCGACCCTAAGAGAAGCGCTCGTGACTCTCACATCCCCGTTTTGGCTCCACTTCCAATTGGATTTGCTGTGTTCATGG
TGCATTTGGCAACCATCCCCATCACTGGAACTGGAATTAACCCAGCGAGAAGCTTTGGTGCTGCTGTTATCTACAACAACGAGAAG
GCATGGGATGACCATTGGATCTTCTGGGTTGGGCCATTCGTTGGAGCATTAGCAGCAGCAGCTTACCATCAATACATTTTGAGAGC
TGCAGCAGTTAAGGCCTTGGCCTCGTTCCGAAGCAGTGCAACCAACTGATGAATGGTGAAGAAAAAAGCTTAAGATTCGTTATGCT
TTTTATTTTTATTTGTTGCTTTATTTGTGTGGTTAATGAGAGAGAGCTTAAGTTGGTGGATTGATGATTAATGTTAATTATGAAAT
GGGTGTATGAATTTTTCTTTCTTTCTTTTTCTACCCACTTTGTTAGCTTTTTCAATATCTAGTTTAGTTTGGTGTGACTTGTGAAT
CATTTTCCTTTCTTAGTTATTATCATTTTCTCTCTAAAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAG30607 aquaporin [Brassica oleracea]14252e-155
NP_195236 aquaporin PIP2-7 [Arabidopsis thaliana]13912e-151
AAB65787 plasma membrane intrinsic protein [Arabidopsis thaliana]13769e-150
AAB36949 plasma membrane intrinsic protein PIP3 [Arabidopsis thaliana]13769e-150
XP_002869108 hypothetical protein ARALYDRAFT_491143 [Arabidopsis lyrata subsp. lyrata]13751e-149

Swiss-Prot top hits (Blast detail)Scoree value
P93004 Aquaporin PIP2-713917e-153
Q9ZVX8 Probable aquaporin PIP2-813334e-146
P42767 Aquaporin PIP-type12733e-139
Q7XLR1 Probable aquaporin PIP2-612026e-131
Q9ATM4 Aquaporin PIP2-711381e-123

TrEMBL top hits (Blast detail)Scoree value
Q9FUC0 Aquaporin14251e-155
C0SVL5 Putative uncharacterized protein At4g35100 (Fragment)13911e-151
Q5DVT5 Plasma membrane intrinsic protein 2;513255e-144
A9PG56 Aquaporin, MIP family, PIP subfamily13211e-143
Q70AP3 Aquaporin13174e-143

Arabidopsis top hits (Blast detail)Scoree value
AT4G35100.1 PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3); water channel13925e-154
AT2G16850.1 PIP2;8 (PLASMA MEMBRANE INTRINSIC PROTEIN 2;8); water channel13342e-147
AT3G53420.1 PIP2A (PLASMA MEMBRANE INTRINSIC PROTEIN 2A); water channel11254e-123
AT3G53420.2 PIP2A (PLASMA MEMBRANE INTRINSIC PROTEIN 2A); water channel11254e-123
AT5G60660.1 PIP2;4 (PLASMA MEMBRANE INTRINSIC PROTEIN 2;4); water channel11173e-122

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  11%
 
203  17%
 
71  6%
 
193  17%
 
211  6%
 
111  6%
 
182  11%
 
103  17%
 
81  6%
 
61  6%

Unigene MembersMember information