Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN14924

FASTA Sequence
Unigene ID: UN14924Length: 1211  SNP
ATGTGTGTGGTGGCTATGTATTAAGAAGGAAGAAAAAGTATCATATTGTTTTTTGTTTATATAAAAAAAAAAAGAAGAGAATAAAA
CAGTGTCTTGAGAAAGAACTTTCAGACAAGTAAAAAGACAAACAGAAACATGGGGACATGAATGAAGTTTTATTTGTTCTAAAGAA
AAAACATACACAAGGCACAGTTTCACAACTCAAAAAACCAGCTCAGGTCTGGTTCTTAGTACTACTGAAGCTTCTTGATCCCAGGG
AAGGAAGGAAGGATCGAGATGAGAGCATCATTGTATCCTACAGGCTCTCCATCCTCTCGGAGTATTTTGACAACCTCGCCAGTAAC
ATCAGACTCGATAGGGAATTGGCCACCGAGTTGTTCAATGTAGCAAAGAACTTGACCTTCTTTCACTTGGTCTTTCTCTTTACATG
ACGAAGGAGTACGTTTACCCTTTATGGTTTTGGATCTCCTAAAGAACCCTACTTTTGGAGATTGGAGAACCACCAAACCCTGATCA
GCAGCTGAGGATGTTGGTTTTATGATAGCCAGTGAAGTAGAGGAAGCTGATCCATTCGAATCAACACTCTCCGTGGTTGCATTTGC
AGAAACGGCAGCAGGAATGGGCTGAGGTTGTGGTGGGCTACTGTTGTTGTCAGCTAAGTTCCTTGCTACATATAGGCGGAAACCTC
CTAGTTTCAGTTCAAACTCTGCAATTGATAAGGAGTCGCATATTTCAGTTACAAGAGCTTCCACCTCAGAGGGCTTGGGAACGAGC
TGAGCGTTCAACGGAGATGGCTTCGCCGTCTCAGCATCTTCTACTTTTACAGTAGCTGCAGATTCAGCAGGTGTGACAGTAGACAC
TTGGACAGCTTTCACAGATCCAAGAGTTGTCCTGAGACTCAAGTACTTAGCCGGCCTTTGACCAATCAACACTCTTTGATTGCATG
GTATCTGTAAGCTTCCAGATCTTCTTACTCTACTGAGGTCTACTGCTGAGATTTTAATCTTAGGAACTCCTAGGCTACAGGAAGCC
ATGGAGGCAATGGATTCGAGACAGAGAATGTAAGGCAGAGAGGGATTGAGATTATGAAACCGATGCCGATAACGATACGAACGAGG
GAGTGATGAGAGAATGACAATCAAATCAAATCAAAACAAAATTGAGTTGAACGCCTCTGGTTGGTTTGGTTGGTTGGTTGGGTTCG
CTCGTTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_188190 putative acetyl-CoA carboxylase biotin-containing subunit [Arabidopsis thaliana]10855e-116
XP_002882958 hypothetical protein ARALYDRAFT_479023 [Arabidopsis lyrata subsp. lyrata]10821e-115
BAB02300 unnamed protein product [Arabidopsis thaliana]9672e-102
NP_850591 putative acetyl-CoA carboxylase biotin-containing subunit [Arabidopsis thaliana]9672e-102
XP_002299605 predicted protein [Populus trichocarpa]6241e-062

Swiss-Prot top hits (Blast detail)Scoree value
Q06881 Biotin carboxyl carrier protein of acetyl-CoA carboxylase1533e-009
Q42533 Biotin carboxyl carrier protein of acetyl-CoA carboxylase 1, chloroplastic1362e-007

TrEMBL top hits (Blast detail)Scoree value
Q8GRT9 Putative acetyl-CoA carboxylase biotin-containing subunit10853e-116
Q9LW10 Genomic DNA, chromosome 3, P1 clone: MSJ119672e-102
B9GKX5 Predicted protein (Fragment)6241e-062
Q8VZ68 Is a member of the PF|00364 Biotin-requiring enzymes family4832e-046
Q9SSR9 F6D8.11 protein4511e-042

Arabidopsis top hits (Blast detail)Scoree value
AT3G15690.2 biotin carboxyl carrier protein of acetyl-CoA carboxylase-related10914e-119
AT3G15690.1 biotin carboxyl carrier protein of acetyl-CoA carboxylase-related9722e-105
AT1G52670.1 biotin/lipoyl attachment domain-containing protein4865e-049
AT3G56130.1 biotin/lipoyl attachment domain-containing protein3531e-033
AT3G56130.2 biotin/lipoyl attachment domain-containing protein2706e-024

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
117  30%
 
84  17%
 
125  22%
 
211  4%
 
91  4%
 
62  9%
 
102  9%
 
191  4%

Unigene MembersMember information