Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN15201

FASTA Sequence
Unigene ID: UN15201Length: 844  SNP
AGCAAAGAAACACAGTAAAGTTGTTTTTATTCCAGATACGATGATGATGATTATCGACGAACAAAGAAAGAAGCATAAAGGGAAAG
AGTTTTATTATTAGACGTAAGTTATAACTCTTATCCTCTTCATTAAGTGGTCTTTATTTCTCTCAGATAATAGACATAATCTTGGA
TGAAGTCTCTATCTCACTAGCTTTCACGAACATAACCTCGAATGGGCTAGCGAATGGTGGGGTAGAGCCTATAACCAAACCCCGAA
CGCCACCTTCCTCGTTTCTACCGACATCGGTGCAATCGTTACCGTCCCTACAATATGCAAACTTGTAAGCGTTAGGGTTTTCACTA
GTTTTCTTGATCTGGAAGAAACTCCTCGACGAATCTTCTCCTCCAGCTTCTGGCTTAGGACCAACCGCTATGAACAACGATCTCCA
GGGACTGGGGGCTGGAGTGACCCACCAATAAGTTGACTCAGCGCAGAACGTAGGTTCGACATCCATCTCGATGTTGAGGTTCTCTG
ATTCGGGGACGAACCCAACTCTAGACCTCCAGTTTGAAAATTTCACGGGAATGCCCCTCCTGAGATCTGAACGCTCCTGTCCGATA
AAGAGGGGACACTGGTTGCCATTACGGGGGGTGAGAGTTAGGCCGCCACCTCCAGCGCCCCTGATGACGGAGATAGCGTAGTAACT
GCCGCCGAATATGATATCACCATTCACGTCGAGAACTGGTCCGGCGTTTGCGGTGGCAGCCAAAACAGCTGTTAGGGCAAGAAGGA
AGTAAAACATAGGATTCATCTTTTTTTTTGAGTTTATTTAGTTGATGAGATTTGAATGTTACCTGGACCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAB68964 trypsin inhibitor propeptide [Brassica oleracea]9331e-098
ACC66057 trypsin inhibitor [Brassica oleracea var. botrytis]7502e-077
ACC66058 trypsin inhibitor [Brassica oleracea var. botrytis]7493e-077
ACC66061 trypsin inhibitor [Tropaeolum majus]7483e-077
ACC66059 trypsin inhibitor [Raphanus sativus]7242e-074

Swiss-Prot top hits (Blast detail)Scoree value
P83667 Kunitz-type serine protease inhibitor DrTI2525e-021
P32765 21 kDa seed protein2167e-017
O82711 Kunitz-type trypsin inhibitor-like 2 protein1989e-015
P81726 Subtilisin inhibitor CLSI-II1908e-014
Q41015 Kunitz-type trypsin inhibitor-like 1 protein1891e-013

TrEMBL top hits (Blast detail)Scoree value
Q39369 Trypsin inhibitor propeptide9338e-099
B2KSD1 Trypsin inhibitor (Fragment)7501e-077
B2KSD2 Trypsin inhibitor (Fragment)7492e-077
B2KSD5 Trypsin inhibitor (Fragment)7482e-077
B2KSD6 Trypsin inhibitor (Fragment)7482e-077

Arabidopsis top hits (Blast detail)Scoree value
AT1G73260.1 trypsin and protease inhibitor family protein / Kunitz family protein4901e-049
AT1G17860.1 trypsin and protease inhibitor family protein / Kunitz family protein1388e-009

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
124  9%
 
720  43%
 
910  22%
 
113  7%
 
67  15%
 
81  2%
 
101  2%

Unigene MembersMember information