| | | |

FASTA Sequence

Unigene ID: UN15390	Length: 483		SNP
GGACTTATTTTGAAACAAAAAATTTCCTCTAGAACTACATATAATTTGAAACGGAGGGAGTAACTTTCTACGTCAAATTCATTACT CTTTTTGTTAGGAAAAGTATAAATTTGAAATAAGAAAATGGCAACTAACAAAATCTCCTTCTTCTTGGTTCTTTGCATCTGTGTTT TGTTATCCTCAGGATTTGGAAAAGCAGCACTAAATCCAACGGGAAAAAAATGTCCGGATCCAAATGGTGTAGACAAAAAAGCTGCA TGTTATAGCTACTGCAAAACACAGGGTTTTATGGGTGGTTCTTGTCAAGGACATAAAGGTAATTACATGTGTAAGTGTTATGAAGG TAAATGAATATTTGCGAATTTTGTTACTTTCAAATACTCGTTGGTTTGGTTTTATGAGGAATAATAAACGCAAATAAATACTTTAG TTGATGTATTTGTTTTATTCTACTTTTCAATATTTAAGATATTTTTCACGACC

Annotation (GO term)

GenBank top hits (Blast detail)	Score	e value
XP_002887260 hypothetical protein ARALYDRAFT_315984 [Arabidopsis lyrata subsp. lyrata]	289	9e-025
NP_001031227 defensin-like protein 35 [Arabidopsis thaliana]	287	2e-024
XP_002886357 F22C12.4 [Arabidopsis lyrata subsp. lyrata]	274	5e-023
NP_001031258 putative defensin-like protein 33 [Arabidopsis thaliana]	260	2e-021
NP_001031257 defensin-like protein 34 [Arabidopsis thaliana]	259	3e-021

Swiss-Prot top hits (Blast detail)	Score	e value
Q2V4F3 Defensin-like protein 35	287	1e-025
Q2V4D6 Putative defensin-like protein 33	260	2e-022
Q2V4D7 Defensin-like protein 34	259	3e-022
Q2V4D5 Putative defensin-like protein 36	198	3e-015

TrEMBL top hits	Score	e value
No hits found

Arabidopsis top hits (Blast detail)	Score	e value
AT1G64195.1 Encodes a defensin-like (DEFL) family protein.	296	1e-027
AT1G69825.1 Encodes a defensin-like (DEFL) family protein.	260	2e-023
AT1G69818.1 Encodes a defensin-like (DEFL) family protein.	259	3e-023
AT1G69828.1 Encodes a defensin-like (DEFL) family protein.	198	3e-016

EST library breakdown for ESTs in the assembly

Library

ESTs

Percentage of ESTs in assembly


7	2			14%


8	3			21%


10	1			7%


12	3			21%


6	5			36%

Software error:

can't close file: No space left on device at /var/www/cgi-bin/radish/EST/search.cgi line 576.

For help, please send mail to the webmaster (feibioinfolab@gmail.com), giving this error message and the time and date of the error.