Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN15390

FASTA Sequence
Unigene ID: UN15390Length: 483  SNP
GGACTTATTTTGAAACAAAAAATTTCCTCTAGAACTACATATAATTTGAAACGGAGGGAGTAACTTTCTACGTCAAATTCATTACT
CTTTTTGTTAGGAAAAGTATAAATTTGAAATAAGAAAATGGCAACTAACAAAATCTCCTTCTTCTTGGTTCTTTGCATCTGTGTTT
TGTTATCCTCAGGATTTGGAAAAGCAGCACTAAATCCAACGGGAAAAAAATGTCCGGATCCAAATGGTGTAGACAAAAAAGCTGCA
TGTTATAGCTACTGCAAAACACAGGGTTTTATGGGTGGTTCTTGTCAAGGACATAAAGGTAATTACATGTGTAAGTGTTATGAAGG
TAAATGAATATTTGCGAATTTTGTTACTTTCAAATACTCGTTGGTTTGGTTTTATGAGGAATAATAAACGCAAATAAATACTTTAG
TTGATGTATTTGTTTTATTCTACTTTTCAATATTTAAGATATTTTTCACGACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002887260 hypothetical protein ARALYDRAFT_315984 [Arabidopsis lyrata subsp. lyrata]2899e-025
NP_001031227 defensin-like protein 35 [Arabidopsis thaliana]2872e-024
XP_002886357 F22C12.4 [Arabidopsis lyrata subsp. lyrata]2745e-023
NP_001031258 putative defensin-like protein 33 [Arabidopsis thaliana]2602e-021
NP_001031257 defensin-like protein 34 [Arabidopsis thaliana]2593e-021

Swiss-Prot top hits (Blast detail)Scoree value
Q2V4F3 Defensin-like protein 352871e-025
Q2V4D6 Putative defensin-like protein 332602e-022
Q2V4D7 Defensin-like protein 342593e-022
Q2V4D5 Putative defensin-like protein 361983e-015

TrEMBL top hits Scoree value
No hits found  

Arabidopsis top hits (Blast detail)Scoree value
AT1G64195.1 Encodes a defensin-like (DEFL) family protein.2961e-027
AT1G69825.1 Encodes a defensin-like (DEFL) family protein.2602e-023
AT1G69818.1 Encodes a defensin-like (DEFL) family protein.2593e-023
AT1G69828.1 Encodes a defensin-like (DEFL) family protein.1983e-016

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
72  14%
 
83  21%
 
101  7%
 
123  21%
 
65  36%

Software error:

can't close file: No space left on device at /var/www/cgi-bin/radish/EST/search.cgi line 576.

For help, please send mail to the webmaster (feibioinfolab@gmail.com), giving this error message and the time and date of the error.