Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN15969

FASTA Sequence
Unigene ID: UN15969Length: 1009  SNP
GGACGAAAAAGGGCTCAGCTTATGAAAGTCGATATTTCGAGACATGGTACATGTTAAAATGCGGAATTTTATATAAAATATGACCT
TAAAGATATAAAACATTCGTTCAGGAAAAAGAAATACATTTTACTCAACAAAATAAATATAAATACATTTTACCTGAACATAGTAA
ACATTCCAAAGATTGAGAAATCTTTGTAGACTCAATCACTCATATGATTCTAAACCGTCAAGTACTTTAGAACCGAAGCACGTACC
TTCTCCATGTAATCTCCTGCTTCTTTCTGGTTCCCTCTGTATGCATTAGCTATGTTTTCATCAAGAAGAGTCAACAGAGATCTGTT
GATCTCGTTTTTCTCCACCATATCCAACAATGTTGCTTTGATATCGGTTGAGGTTAAGATCTTGGTTAAGCTATTTGTAGCCGTCA
TAAGCTCCTTTTGCATTTTGTCATAAGCCTCAATTCCTTCTTCTAAGGCTTTCTGAAGTGATTCAAGCTCAATCAATCTGTCTTCA
TCTTCCGCGGTTTTTGTAACAGCAAACCGGATTTGCCCGATTTCAAGTCGAATTTGCGCAAAAAACTCGTCGTTTAACCTTCCACG
AAGCCTAGCGATTTCGAATTCAATCTCCTGAGCTTCCGTGTCAAGAAAGAACTCAATCAGCTCAGCGGAAGTATCTGGTACAACTC
TAGACTCTCTAAGAGCTTGACGACGCTCTCTCTCTTCACGGAGTTGTTTCTGGAAAGCTTCTTTAGCCTCGGAGTCTCTCTCTATC
CTGCGTTTGAACTCAAGACGAGCGATATGGCCAGTTTGTGCTGGTCCTAGTATACCTTTGGGATCCCATTCGCAGGAGATTTTGCT
CCTTCGTGTATTAATTCTCGGGACTTTACGGACGGTGTTCGCGAAGGCGATTCCTATTGAGAGCGAAGCCATTGTTATACTTTTTT
TTTCTGGGAGGCTCTGCTTTCACTAGCTACGTTACGTTATCTCCTTAACTATCTATCTCTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002886454 hypothetical protein ARALYDRAFT_475075 [Arabidopsis lyrata subsp. lyrata]10739e-115
NP_176466 uncharacterized protein [Arabidopsis thaliana]10487e-112
XP_002509586 conserved hypothetical protein [Ricinus communis]7906e-082
CAN83165 hypothetical protein VITISV_040233 [Vitis vinifera]7549e-078
XP_002264554 PREDICTED: hypothetical protein [Vitis vinifera]7522e-077

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8VY70 Putative uncharacterized protein At1g6278010485e-112
B9RBQ2 Putative uncharacterized protein7904e-082
A5BEK8 Putative uncharacterized protein7546e-078
B9N3N8 Predicted protein7214e-074
B8AU81 Putative uncharacterized protein7197e-074

Arabidopsis top hits (Blast detail)Scoree value
AT1G62780.1 unknown protein10492e-114

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
722  55%
 
62  5%
 
89  23%
 
92  5%
 
102  5%
 
111  3%
 
122  5%

Unigene MembersMember information