Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16121

FASTA Sequence
Unigene ID: UN16121Length: 980  SNP
GGGTAAAAGGACTATCGTGCAATACGTAGTAAAGTAAAATTCTTAAATTAATTAAAAAAAAATAAATACAAAGGGAACCCCTAAAT
TGTTTCTTCTCCCCGCCGCCGCTGTGCCGAATCGACGTTGCGTTGTACCGCCACAATCGGTCGTAGATGGCTTACAGAGGAGGACG
AGGAAGAGGAAGAGGTGGGTTTGGTGGGTTTGGCGTTGAGTACGCAAAGGCCGAACCTTTCGTTATCTTCCCTGACATTACGTTAC
CTGACCGTAAATCAATCTCAGACGATACCCAATTACTTAAGAACTTCAATTATTTTGAGAGGTTCTGGAAAAGTTCGCCTTACCAC
TTAGGCGATGGTGTTTCAAAGAAAGAGAGTGAGAGTTTAGACATTGAGAGGTTCTCAGACACGTTGAAGCCGAAGAAGACGAAGTC
TAATGCGAGGGGATCTTTCTATGACTTTCTTGTTCTTAGACCTGATAACTTCCCTAAAGAACTTCTTGGAGATAGTCGAAGAGAAC
GGCCTGTGAAGAGAGCTAGATGGACTCAAGACGCAGATCTGCAGAAGCTGGAGGCCTTGGAGAAACTTGAAGCGAAGCTTAAGGCT
GATGGCAAGGAAGAGAATGAAGAAGGAGAAGGTGATGATGAAGTTGAGGAATCCGAGGGAGAAGATTCTGATAACGGAGACTATGA
TAAGAATAAAGACTTTGACGATGATGATGACGATTATAACGAGCCGGAGGATAACGATAATGAAGAAGTGTATATTTAAGGCTTCT
TTTTCTTTATGTCTTCCCAAAAAAAGGATCAAGTTTTGAGTGCAAGAGATGGTGGAAACTCAATTTTAATTACCTTCAAACCCTCT
TAGAATAATACAAGCGCAATTTTTGGCATTTGTTGCTTTCATTCTTTTTTTTTTTTTGCTTTAATCTATTGGGAATTAGCTGTAAT
ACACATAAAAAGGTCAAAAATAAAGTTTCTAACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ACA61620 hypothetical protein AP6_E08.1 [Arabidopsis lyrata subsp. petraea]7289e-075
NP_192069 uncharacterized protein [Arabidopsis thaliana]7243e-074
NP_001031569 uncharacterized protein [Arabidopsis thaliana]7208e-074
XP_002872883 hypothetical protein ARALYDRAFT_912071 [Arabidopsis lyrata subsp. lyrata]5406e-053
XP_002515951 conserved hypothetical protein [Ricinus communis]4724e-045

Swiss-Prot top hits (Blast detail)Scoree value
Q17RH7 Putative protein TPRXL1352e-007
O77384 LRR domain-containing protein PFC0760c1343e-007
Q8I3Z1 MATH and LRR domain-containing protein PFE0570w1253e-006
P87179 Cell wall integrity and stress response component 11227e-006
Q75JC9 Uncharacterized protein DDB_G02716701211e-005

TrEMBL top hits (Blast detail)Scoree value
B1PBY7 Putative uncharacterized protein7286e-075
Q9M123 Putative uncharacterized protein AT4g015907242e-074
Q2V2Q7 Putative uncharacterized protein At4g01590.27205e-074
B9RQD2 Putative uncharacterized protein4723e-045
Q9ZSH8 T15B16.1 protein4472e-042

Arabidopsis top hits (Blast detail)Scoree value
AT4G01590.1 unknown protein7241e-076
AT4G01590.2 unknown protein7203e-076
AT4G35680.1 unknown protein3762e-036
AT4G26600.1 nucleolar protein, putative1281e-007
AT5G63740.1 zinc finger protein-related1121e-005

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
93  16%
 
103  16%
 
123  16%
 
64  21%
 
74  21%
 
111  5%
 
81  5%

Unigene MembersMember information