Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16150

FASTA Sequence
Unigene ID: UN16150Length: 892  SNP
AACAATCTCTAGAGCTACAATACCAAAGCTGTACACATCAACTTTATCTGTCAAATGGCCACTCTGCGTTGATACCACTGCTTACG
GCCGGGGGGGATCTTTCTTTCTCTAGTCGAAGACGACGAATCGATATTTCTCTCGCAAATCTAGATTGTTCGTGTGGAGAGAGGAA
GACGGCGATGGGAAGTGGGCGAGAAGTCAGCGTGTCGCTAGATGGAGTCAGAGACAAAAACATGATGCAGCTTAAGAAACTCAACA
CTGTGCTCTTCCCGGTTCGCTACAACGACAAGTACTACGCTGATGCCATCGCATCCGGCGAGTTCACTAAGCTTGCTTATTACAGT
GATATATGTGTTGGAGCTATTGCTTGTCGGCTGGAGAAGAAAGAAGGCGGGGCCATGAGAGTGTATATAATGACACTTGGTGTTCT
TGCACCATACCGCGGCATTGGCATTGGTTCAAAGCTACTGAATCATGTTCTTGAGATGTGCTCCAAGCAGAACATGTCGGAAATAT
ACTTGCATGTTCAGACAAACAACGAAGATGCGATCAAGTTCTACAAGAAATTTGGGTTTGAGATCACAGATACCATACAAGACTAT
TACGTCAACATCGAGCCTAGAGATTGCTATGTTGTCACCAAGTCCTTTGCTCAATCTGAAGCCAGCAAATGATGACAATACGTTAC
TTCGGGAAGCCATTCTTCCCCGCCCCGTTTGTTTGTTTCACTGAAGATTCCATTCTTGAAGTTCTGATGTTTTGGTTTCGTGAGTT
TTACTTGTTTTGATGACCCCAAAGTTATAGATACATGGTTGTCTAGTGACCCCTTGGTTTTGGACCTCTTAGTTGGGGAGGTGTTA
ACTTTGCAGCTCTCAATCATTATTACTACTCG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002871470 hypothetical protein ARALYDRAFT_909096 [Arabidopsis lyrata subsp. lyrata]8254e-086
NP_196695 GCN5-related N-acetyltransferase (GNAT) family protein [Arabidopsis thaliana]7978e-083
XP_002284766 PREDICTED: hypothetical protein [Vitis vinifera]7385e-076
XP_002308640 predicted protein [Populus trichocarpa]7252e-074
XP_002514360 Pre-mRNA-splicing factor cwc24, putative [Ricinus communis]7224e-074

Swiss-Prot top hits (Blast detail)Scoree value
Q6DBY2 N-alpha-acetyltransferase 50, NatE catalytic subunit4282e-041
Q9NHD5 Probable N-acetyltransferase san4282e-041
Q0IIJ0 N-alpha-acetyltransferase 50, NatE catalytic subunit4264e-041
Q9GZZ1 N-alpha-acetyltransferase 50, NatE catalytic subunit4264e-041
Q6PGB6 N-alpha-acetyltransferase 50, NatE catalytic subunit4264e-041

TrEMBL top hits (Blast detail)Scoree value
Q9LFM3 At5g113407975e-083
A5BJF0 Putative uncharacterized protein7384e-076
B9H9R5 Predicted protein7251e-074
B9RK06 Pre-mRNA-splicing factor cwc24, putative7223e-074
B9IKT2 Predicted protein7161e-073

Arabidopsis top hits (Blast detail)Scoree value
AT5G11340.1 GCN5-related N-acetyltransferase (GNAT) family protein7982e-085
AT2G38130.1 ATMAK3; N-acetyltransferase1423e-009
AT2G38130.2 ATMAK3; N-acetyltransferase1423e-009
AT5G16800.2 GCN5-related N-acetyltransferase (GNAT) family protein1299e-008

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
106  21%
 
127  24%
 
95  17%
 
86  21%
 
63  10%
 
112  7%

Unigene MembersMember information