Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16193

FASTA Sequence
Unigene ID: UN16193Length: 1416  SNP
GGATCGTGGAACACCCATATTCTCTCGTTTCTCTCTATTTCTTCTTCGTTCCTCGATCTTCTCCGTCGCCGATCTCGCCACTTCAT
TTCCCGCGAGTTGATTTGGTACAAAGCGTTGAGAACAAAAAATGGTAGGAGGAGGAGTTATCCAGCAGATTCTCAGGAGGAAGCTT
CACTCCCAATCCCTCGCAACTCCGGTCCGGTCGTGGTTTTCTTCGAAGACTGCTCATGTGGATGCTGGGTCTTCTGGTGTGAGAGC
ATTTGCGCTCTTGGGTGCTGGTGTTACTGGGCTGTTGAGTTTTTCTACAGTAGCATCTGCTGATGAGGCCGAACACGGGTTGGCTT
GTCCAGACTACCCTTGGCCTCATGATGGCATTCTCAGCTCATATGACCATGCCTCGATCCGTCGTGGGCATCAAGTTTATCAGCAG
GTGTGTGCATCTTGCCACTCGATGTCTCTCATCTCATACCGAGATTTGGTGGGTGTCGCCTACACAGAGGAAGAGGCAAAGGCAAT
GGCAGCTGAAATCGAGGTGGTTGATGGACCTAATGATGAGGGTGAGATGTTCACCCGTCCTGGTAAACTCAGTGACCGCTTGCCTC
AACCTTATGCCAATGAATCAGCGGCAAGGTTTGCTAATGGTGGAGCGTATCCTCCTGATCTCAGTCTTATCACTAAGGCACGTCAC
AACGGTCAAAACTACGTCTTTGCTCTCCTGACGGGTTACCGTGATCCTCCTGCTGGCATTTCAATTAGAGAGGGGTTACACTACAA
TCCTTACTTCCCAGGGGGAGCAATTGCTATGCCGAAAATGCTCAATGATGAAGCTGTTGAGTATGAAGATGGTGTCCCCGCCACAG
AGGCACAGATGGGTAAAGATGTTGTGTCATTCTTGTCTTGGGCAGCTGAACCAGAAATGGAAGAGAGGAAGTTGATGGGTTTCAAA
TGGATATTCCTACTATCTCTCGCTCTCCTCCAAGCAGCGTACTACAGGCGACTGAAATGGTCGGTTCTCAAGTCTCGCAAGCTGGT
TCTTGACGTGGTGAACTAAAATCACTGCGTAGTAAGCTTTTGCAGTTGGCTACTACACTGTCCTCTTTTCAGCAAAAATCTCCATT
TTATGTCATAAAAATCTTTGATGGGACCATCCGTTCTCGCCGGAAGGTGGAAAATCTCATCTTTTCTTAATTTTTTTTACTTCTGA
GTATCTCTAGGGAGTTTTATGAGGATAATAACGACAAAAAATATTTCTGCCTCATAATCAAACATGATTTTGTGGTTTATACATTT
TGTTTCTTGTCCATGCCGATACGGTTCAGCTTTCGGGTTTGTTTCAATAAAGAATATCTTTGTACTTGGTTTCCTGGTTTGCTTTC
GGTGTTCTTCCTTTTTGAGTTTGTTACTCTCTTTTTCGCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_189360 ubiquinol-cytochrome c reductase cytochrome c1 subunit [Arabidopsis thaliana]15435e-169
XP_002877032 AT3g27240/K17E12_6 [Arabidopsis lyrata subsp. lyrata]15418e-169
AAM65645 cytochrome c, putative [Arabidopsis thaliana]15391e-168
AAL51110 AT3g27240/K17E12_6 [Arabidopsis thaliana]15382e-168
NP_198897 ubiquinol-cytochrome c reductase cytochrome c1 subunit [Arabidopsis thaliana]15265e-167

Swiss-Prot top hits (Blast detail)Scoree value
P25076 Cytochrome c1-1, heme protein, mitochondrial13272e-145
P29610 Cytochrome c1-2, heme protein, mitochondrial (Fragment)12896e-141
Q9D0M3 Cytochrome c1, heme protein, mitochondrial8147e-086
P00125 Cytochrome c1, heme protein, mitochondrial8058e-085
P08574 Cytochrome c1, heme protein, mitochondrial7994e-084

TrEMBL top hits (Blast detail)Scoree value
Q9LK29 Ubiquinol-cytochrome c1 reductase cytochrome c1-like protein15433e-169
Q8LA08 Cytochrome c, putative15391e-168
Q940N2 AT3g27240/K17E12_615381e-168
Q9FKS5 Cytochrome c115263e-167
Q0WNJ4 Cytochrome c115211e-166

Arabidopsis top hits (Blast detail)Scoree value
AT3G27240.1 cytochrome c1, putative15441e-171
AT5G40810.1 cytochrome c1, putative15271e-169
AT5G40810.2 cytochrome c1, putative13406e-148

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
126  22%
 
103  11%
 
62  7%
 
76  22%
 
118  30%
 
91  4%
 
181  4%

Unigene MembersMember information