Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16232

FASTA Sequence
Unigene ID: UN16232Length: 1796 SSR 
AGGGGATAATTATCTTCATCACCCTCTCCTCGTTTTGCTAAATCTCTGGAAGTCTCTCTCTCTCTCTCTTTCTCAACTCTCATCAA
CCATGGATCCTTACAAGTATCGTCCAGCGAGTTCATACAACTCTCCATTCTTCACCACCAACTCTGGTGCTCCTGTATGGAACAAC
AACTCCTCCATGACCGTTGGACCCAGAGGTCCTATCCTTCTTGAGGATTACCATCTCGTCGAGAAGCTTGCTAACTTCGACAGGGA
GCGTATTCCAGAGCGTGTGGTTCATGCTAGAGGAGCCAGTGCGAAGGGTTTCTTTGAGGTCACTCATGATATATCCAACCTCACGT
GTGCTGACTTCCTCAGAGCTCCAGGTGTTCAGACTCCAGTCATTGTTCGTTTCTCCACTGTCATCCATGAGCGTGGAAGTCCCGAG
ACCTTGAGAGACCCTCGTGGCTTTGCAGTCAAGTTCTACACCAGAGAGGGGAACTTTGATCTTGTCGGAAACAACTTCCCTGTCTT
CTTCATCCGTGACGGGATGAAATTCCCTGACATGGTCCACGCTCTCAAGCCAAACCCCAAATCTCACATCCAAGAGAACTGGAGAG
TCCTTGACTTCTTCTCCCACCACCCTGAGAGCCTCAACATGTTCACTTTCCTCTTTGATGACATTGGTATCCCACAAGACTACAGG
CACATGGAAGGTTCAGGTGTCAACACATACATGTTGATCAACAAATCCGGCAAAGCACACTACGTGAAGTTCCACTGGAAACCAAC
TTGTGGAGTCAAGTCTCTGTTAGAAGAAGATGCAATCCGCGTCGGTGGAACCAACCATAGCCACGCAACTCAGGACTTGTACGACT
CCATCGCTGCTAGTAACTACCCTGAGTGGAAGCTCTTTGTTCAGATAATCGATCCGGCGGATGAAGACAAGTTCGACTTTGACCCT
CTCGATGTGACCAAGACCTGGCCTGAGGATCTCTTGCCTCTCCAGCCCGTTGGTCGTATGGTGTTGAACAAGAACATTGATAACTT
CTTTGCGGAGAATGAGCAGCTTGCCTTCTGCCCTGCGATCATTGTTCCGGGGATACACTACTCTGATGACAAGCTGCTTCAAACAC
GTGTCTTCTCCTATGCGGATACTCAGAGACACCGTCTTGGACCTAACTACCTTCAGCTACCAGTGAATGCTCCAAAATGTGCTCAC
CACAACAACCACCATGAGGGCTTCATGAATTTCATGCACAGGGACGAGGAGGTTAACTACTTCCCTTCGAGGTATGACCCGGTTCG
CCATGCTGAGAAGTATCCAACTCCACCAGCAGTCTGCTCTGGGAAGCGTGAGAGGTGCATTATTGAGAAAGAGAACAACTTCAAGG
AGCCTGGAGAGAGATACCGTTCCTTTACACCAGAGAGGCAAGAACGTTTCATCGGTAGATGGATTGATGCTCTATCAGACCCTCGC
ATCACACATGAAATCCGCAGTATCTGGATCTCTTACTGGTCTCAGGCTGATAAGTCACTGGGACAGAAGCTGGCAAGCCGTCTGAA
CGTGAGACCAAGCATCTAAAACGAGTGAACAAGATTCTTGATTGGTCGTTGTGTGGTTCTAATAGGCAAGAGAAGAAAGATGGGAA
GAGATCAGATGTGCCATGGTATAATCTTCATCATGTGGATCTTGTGTGTTGTGTTGTAGTATTATTTGTTTTAAGACCAAAACAAA
AACTTTTGTTGTGTTGTGTAACCTTGGTTTTGTCTCACTTGGTTATTTACAAATAATAATACATCAAAGATTTTAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAF71742 catalase [Raphanus sativus]26801e-300
AAD17934 catalase [Brassica juncea]26728e-300
ACV92695 catalase [Brassica oleracea]26711e-299
AAD17936 catalase [Brassica juncea]26655e-299
AAB86582 catalase [Raphanus sativus]26583e-298

Swiss-Prot top hits (Blast detail)Scoree value
P25819 Catalase-226519e-299
P48350 Catalase isozyme 125041e-281
P17598 Catalase isozyme 124913e-280
P30567 Catalase isozyme 224833e-279
P49317 Catalase isozyme 324636e-277

TrEMBL top hits (Blast detail)Scoree value
Q9M4X3 Catalase26807e-301
Q9ZPK6 Catalase26726e-300
C9EH44 Catalase26717e-300
Q9ZPK5 Catalase26654e-299
O22640 Catalase26582e-298

Arabidopsis top hits (Blast detail)Scoree value
AT4G35090.1 CAT2 (CATALASE 2); catalase26526e-300
AT4G35090.2 CAT2 (CATALASE 2); catalase25612e-289
AT1G20630.1 CAT1 (CATALASE 1); catalase24171e-272
AT1G20620.1 CAT3 (CATALASE 3); catalase21786e-245
AT1G20620.5 CAT3 (CATALASE 3); catalase21293e-239

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
104  31%
 
213  23%
 
121  8%
 
181  8%
 
111  8%
 
202  15%
 
71  8%

Unigene MembersMember information