Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16238

FASTA Sequence
Unigene ID: UN16238Length: 931 SSRSNP
GGCTCTGCGCCGCGCTCACTCTCTCTCTCTCTCTCTCAGATAATACCTTCCGCTCAAAGGAAGAAAATGGCAGAATCTAAGATGGT
GGTTCCAGAGTCTGTCTTGAAAAAGATCAAGAGGGAAGAGGAATGGGCATTGGCCAAGAAGCAAGAAGCTGAAGCTGCTAAGAAGA
AGAGCGTTGAGACCCGCAAGCTTATCTTCAAGAGAGCTGAGCAATACGCTAAAGAATACGCTGAGAAGGACAATGAGTTGATCAGG
TTGAAGCGTGAGGCTAAGTTGAAAGGAGGGTTCTACGTTGATCCAGAGGCTAAACTTCTCTTTATCATTCGTATCCGTGGAATCAA
CGCTATTGATCCAAAAACCAAGAAGATTCTGCAGCTCCTGCGTTTGAGACAAATCTTCAATGGTGTGTTCCTTAAGGTGAACAAGG
CAACAATCAACATGTTGCGTCGCGTTGAGCCTTACGTGACCTACGGGTACCCAAACCTGAAGAGCGTTAAGGAGCTGATCTACAAG
AGAGGATTTGGAAAGCTGAACCACCAGAGGATAGCGCTCACGGACAACTCTATAGTGAGCCAAGGTCTAGGAAAGCACAACATCAT
CTGCGTGGAGGATCTGATCCACGAGATCATGACCGTTGGACCTCACTTCAAAGAAGCCAACAACTTCCTTTGGCCCTTCCAGCTGA
AGGCGCCGCTCGGTGGACTTAAGAAGAAGAGGAACCACTACGTTGAAGGTGGTGATGCTGGGAACAGAGAGAACTTCATCAACGAG
CTTGTCAGGAGAATGAACTGACTGATCAAAAGCTTTCCTTATTTTGTCTTTGTTCTTATATCAGTGACCGTGTTATGATGATTATG
TTACTTGTTTACGATCATCTTATTTGACTTTTGCTTACTTTTTTAAGTCGAAAAGCAGCCCCGCCCATCAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002862275 60S ribosomal protein L7 [Arabidopsis lyrata subsp. lyrata]11973e-129
NP_850411 60S ribosomal protein L7-3 [Arabidopsis thaliana]11956e-129
NP_850410 60S ribosomal protein L7-3 [Arabidopsis thaliana]11948e-129
XP_002880084 60S ribosomal protein L7 [Arabidopsis lyrata subsp. lyrata]11948e-129
AAO00739 Unknown protein [Arabidopsis thaliana]11875e-128

Swiss-Prot top hits (Blast detail)Scoree value
P60039 60S ribosomal protein L7-311943e-130
Q9LHP1 60S ribosomal protein L7-411504e-125
P60040 60S ribosomal protein L7-211442e-124
Q58DT1 60S ribosomal protein L77544e-079
Q7SBD5 60S ribosomal protein L77544e-079

TrEMBL top hits (Blast detail)Scoree value
Q3EBG6 Putative uncharacterized protein At2g44120.211954e-129
B9HK59 Predicted protein10817e-116
C9E0S6 Putative uncharacterized protein10763e-115
Q38HU4 Thaliana 60S ribosomal protein L7 (At2g44120)10753e-115
A9PGL2 Putative uncharacterized protein10736e-115

Arabidopsis top hits (Blast detail)Scoree value
AT2G44120.2 60S ribosomal protein L7 (RPL7C)11962e-131
AT2G44120.1 60S ribosomal protein L7 (RPL7C)11952e-131
AT3G13580.3 60S ribosomal protein L7 (RPL7D)11513e-126
AT3G13580.2 60S ribosomal protein L7 (RPL7D)11513e-126
AT3G13580.1 60S ribosomal protein L7 (RPL7D)11513e-126

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
108  33%
 
85  21%
 
62  8%
 
111  4%
 
126  25%
 
92  8%

Unigene MembersMember information