Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16257

FASTA Sequence
Unigene ID: UN16257Length: 1340 SSRSNP
GGACACACGTGGCAGGAAAAAACATAATCTTCGAGATTTTCTTCCTTTTTTTTCCCTTTCCCGGAAAAAAAATCAATTTTCTTGTT
GAGTTGAGCCGAAGGAAGAAGGGAGATAGAACGATTTGGGTGTTTTCTCTCACTACTAAGCTAAACCCACCACCACCAACCCTTTT
TGGGGGATTCTAGTGGGGAGAAAGAAGCTTGAATCTTACTCTTTATTTGAAAAAGAAGGAATAGAATCTAGAGTATCGGATATGTC
GAGCTCAGTATCCACTTCGTTGTGCTGTTCGTCAACCCAGGTCAATGGGTTCGGGTTTAGGCCTCAAAGGTCGCTCCTTTACCAAC
CCACTTCCTTTTCTTCTTTCTCCAGAAGGAGAACTCATGGCGGTGTTGTGAAGGCCACAGCTCGTGTTGATAAGTATTCCAAGAGT
GATATCATCGTCTCTCCCTCCATTCTCTCTGCTAATTTCGCCAAACTAGGCGAGCAGGTAAAAGCAGTAGAGTGTGCAGGTTGTGA
TTGGATCCATGTTGATGTGATGGATGGTCGTTTTGTTCCCAACATCACTATTGGACCTCTTGTGGTTGATGCTTTGCGTCCTGTTA
CTGATCTTCCTTTGGATGTTCATCTTATGATAGTGGAACCAGATCTGAGGGTACCAGATTTCATCAAAGCAGGTGCAGACATCGTC
AGTGTACACTGTGAGCAGTCATCCACCATCCATTTGCACCGCACTGTCAATCAAATCAAAAGCTTAGGTGCTAAAGCTGGAGTTGT
TCTAAACCCTGGAACCCCATTGAGTGCTATAGAATATGTATTGGAGGTGGTGGATCTGGTCTTGATAATGTCGGTCAACCCCGGGT
TTGGTGGACAGAGCTTTATCGAAAGCCAAGTTAAGAAAATCTCGGATTTGAGAAGAATGTGTGTCGAAAAGGGAGTAAACCCATGG
ATTGAAGTTGATGGTGGTGTCACTCCAAAGAATGCATACAAGGTTATTGAGGCTGGAGCAAATGCTCTAGTAGCTGGATCAGCTGT
ATTTGGAGCTAAAGACTATGAAGAAGCTATAAAAGGAATCAAGACCAGCAAGAAGCCAGAAGCTGTGGCTGTGTAATGTGAAGCAA
CAAGCTAAAAAGATCATAAGACAGATCACCGAGATGTTTATGTTGTTGTTGTTGTCATTCACCAGATTCCATTCGACATAAAAAAT
CCATAAGAATCAAACTCTCAATAGTTTTGAAGTAGCTCGTTTATACTCCTCCTGTGTATCATTGTCTTGTAGATTTGGGGATATGC
AGATTCAATACATTATGCAATTAATAAGAAATAAGCTGTGTTACATATGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_200949 D-ribulose-5-phosphate-3-epimerase [Arabidopsis thaliana]12943e-140
XP_002866432 hypothetical protein ARALYDRAFT_919384 [Arabidopsis lyrata subsp. lyrata]12943e-140
XP_002330128 predicted protein [Populus trichocarpa]12182e-131
XP_002284772 PREDICTED: hypothetical protein [Vitis vinifera]11823e-127
AAM19354 ribulose-5-phosphate-3-epimerase [Pisum sativum]11752e-126

Swiss-Prot top hits (Blast detail)Scoree value
Q43157 Ribulose-phosphate 3-epimerase, chloroplastic11561e-125
Q43843 Ribulose-phosphate 3-epimerase, chloroplastic (Fragment)11372e-123
Q9ZTP5 Ribulose-phosphate 3-epimerase, chloroplastic10971e-118
P74061 Ribulose-phosphate 3-epimerase7985e-084
O34557 Ribulose-phosphate 3-epimerase6623e-068

TrEMBL top hits (Blast detail)Scoree value
Q9SAU2 Putative ribulose-5-phosphate-3-epimerase12942e-140
B9N4C5 Predicted protein12182e-131
Q8S4X2 Ribulose-5-phosphate-3-epimerase11751e-126
C6TMB6 Putative uncharacterized protein11535e-124
A5AF07 Putative uncharacterized protein11213e-120

Arabidopsis top hits (Blast detail)Scoree value
AT5G61410.1 RPE; catalytic/ ribulose-phosphate 3-epimerase12984e-143
AT5G61410.2 RPE; catalytic/ ribulose-phosphate 3-epimerase12984e-143
AT3G01850.1 ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative3971e-038
AT3G01850.2 ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative3971e-038
AT1G63290.1 ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative3872e-037

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
77  20%
 
152  6%
 
211  3%
 
191  3%
 
126  17%
 
97  20%
 
84  11%
 
182  6%
 
114  11%
 
101  3%

Unigene MembersMember information