Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16310

FASTA Sequence
Unigene ID: UN16310Length: 1281 SSR 
TTTTTTTATTTTTCCTCTTCTTCGTCGTCCTCTCTCTCTTTCTCTCTAAGAAAGTGTTTTACTGTTTTCTCTAAATCACTATATGC
TTCAACAGTTACTCCACATTCATACTTGAGAATGTCTGAATCCGCAGCAGCAGCAGCAGCAGCAGAGCATGATTACATAGGTTTGT
CTGAGTTTCCAACCATGGAAGCAACACAAATAATGTCTGACAAAACCGAAGACAACAACAACAACGACGTTCTGAATTTCAAGGCT
ACCGAGTTAAGACTCGGTTTACCCGGTTCTGAGTCACCGGAGCGAGTTGGGTTCATGTCGCTCAAGAGCTCATGTCCTGTGTCAGG
TGCCAAAAGGGTGTTTTCTGACGCCATTAACGGGTCTACCAAATGGGTCTTCTCTCCTGATGTGAAAGACATTAAACCGGCCGTTC
CGGTTAAGGAGAAGAAGAGCTCTGCTCCAGCTTCCAAGGCACAAGTTGTGGGTTGGCCACCGATTAGATCATTCAGGAAGAACACA
ATGGCTTCTTCTCAGTCTCAGAAACAAGATGGTTGTGATAATAATAACAACAACACAGAGACTGAAGGTGGAGAAACTAAGTCTGG
ACCTGAGCCTTGCTTGTATGTTAAAGTGAGCATGGAAGGTGCCCCTTACTTGAGGAAAATCGATCTCAAGACTTACAAGAGCTACC
TTGAACTCTCTTCTGCTCTTGAGAAGATGTTCAGCTGCTTCACTATTGGTCAGTTTGGGTCTCATGGAGGTTGTGGTCGAGATGGG
TTAAACGAGAGTCGCTTAACTGATCTCTTGCGTGGTTCTGAGTATGTTGTTACCTATGAAGACAAAGACAGTGACTGGATGCTGGT
CGGTGATGTCCCTTGGGAAATGTTTATATGCTCCTGTAAGAAGCTGAGGATCATGAAGAGCTCTGAGGCTATAGGCTTAGCTCCAA
GGGTGATGGAGAAATGCAGAAGCCGGAACTAGTAACTGCAGCCCTTTTATGATATGTGATATGATAAAATGATTTGGAAGAATGTT
ATTAAGAAATGTAATAGCCCATTTTGTTTTTCTAAGTATTCTTGTGTGTGTTGTGTGCTAAGAGTGATGTTTGATCCTTCTTAAAA
CAGCCTCTACTACTAATAAGGCCTATTCTGTCTCTAATCCATCAAATGGGTTTTTGTGTATGTGTGTTTTTTTTTTGCTAGGTAAG
ACTTTCATAACTCATATGTATAAAAAGTTTGTCAGTGTGTAAAAGCAGACGCCTTTTTTAAAACTTCATATCCATGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33683 unnamed protein product [Thellungiella halophila]9002e-094
NP_194637 auxin-responsive protein IAA27 [Arabidopsis thaliana]8688e-091
XP_002867425 phytochrome-associated protein 2 [Arabidopsis lyrata subsp. lyrata]8688e-091
CBI36106 unnamed protein product [Vitis vinifera]6242e-062
XP_002284282 PREDICTED: hypothetical protein [Vitis vinifera]5462e-053

Swiss-Prot top hits (Blast detail)Scoree value
Q9ZSY8 Auxin-responsive protein IAA278683e-092
P0C132 Auxin-responsive protein IAA305655e-057
O24407 Auxin-responsive protein IAA165602e-056
Q38825 Auxin-responsive protein IAA75467e-055
Q5Z749 Auxin-responsive protein IAA214974e-049

TrEMBL top hits (Blast detail)Scoree value
D3K0K2 Indole-3-acetic acid inducible 27 (Fragment)6983e-071
D3K0K3 Indole-3-acetic acid inducible 27 (Fragment)6983e-071
D3K0K4 Indole-3-acetic acid inducible 27 (Fragment)6983e-071
D3K0K5 Indole-3-acetic acid inducible 27 (Fragment)6983e-071
B9RQI4 Auxin-responsive protein IAA27, putative5433e-053

Arabidopsis top hits (Blast detail)Scoree value
AT4G29080.1 PAP2 (PHYTOCHROME-ASSOCIATED PROTEIN 2); transcription factor8692e-093
AT3G04730.1 IAA16; transcription factor5781e-059
AT3G23050.1 IAA7 (INDOLE-3-ACETIC ACID 7); transcription factor5556e-057
AT5G65670.2 IAA9 (INDOLE-3-ACETIC ACID INDUCIBLE 9); transcription factor4525e-045
AT2G22670.1 IAA8; transcription factor4481e-044

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  9%
 
111  9%
 
73  27%
 
84  36%
 
91  9%
 
211  9%

Unigene MembersMember information