Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16325

FASTA Sequence
Unigene ID: UN16325Length: 1448 SSRSNP
GGAAAGACCACACCACACACACGCACCTAGCGAGAGAGAGAGAGAGAAGAAATGGCTGCTTCAGTGATGCTTTCATCGGTGACGTT
GAAACCGGCGGGTTTCACGGTGGAGAAGATGTCGGCCAGAGGTTTACCGTCGCTCGCAAGAGCTTCTCCTTCTTCCTTCAAAATCG
TCGCGAGCGGTGTCAAGAAGATCAAGACCGACAAGCCCTTTGGAGTTAACGGCAGCATGGACTTGAGGGACGGCGTCGACGCCTCC
GGCAGAAAGGGCAAGGGTTATGGTGTTTACAAGTTTGTTGACAAGTATGGAGCTAACGTTGATGGATACAGTCCTATCTACAACGA
GGAGGAGTGGTCAGCGAGTGGTGATGTGTACAAGGGAGGAGTCACCGGATTGGCTATTTGGGCAGTGACGCTTGCCGGAATTCTCG
CCGGAGGAGCTCTTCTTGTGTACAACACAAGCGCTTTGGCTCAGTAAATCTTTTAAAAGACATGTTTCTCTCTATGTTTTGTGTTC
TCTGTTTCTCTCTTCTCTGTAATGCTCAGAACATACTTTTGAAATTTATAAAAGAACTCTAGTGTTTGTGTCTGTCCCATCTTTTC
AATGCACAAGAAAAATAACTTGAATACAGTATTATAGAGAAGAGAACCATGAGTGTTGTTGATTAGAACTCGCCAAGCGCGTCTTC
TTCACCTTCTTCATCATGTGAGACCGAGGAGGAGCTGCTGCTAAACAAAGGAGTTGATCGATGAACTTCTCCATCTAACATCGACA
ATCTCACTCTCTTTTCAATTTCGTCTTGAAGAGAAGGGTTCTCCCTTAAGTGCTGCAGTGCTTTCTCTCTTCCTTGCCCAAGCCTT
TGGTCTTCGTAGCTGTACCAAGAACCCTTCTTCACCACAACCTCCATAATCTCAGCACAATCAAGAACACATCCCAGTTTACTAAC
TCCTTCCCCAAACATAATCTCAAACTCTGCTTGCTTATACGGTCTCGAAACCTTGCTCTTCTGTACTCTCACACGAGCCCGAAGAC
CAATATCTTCATCCCCTTTGCTAGATTTGATCTTCCCAGCAGAACGAATTTCTAGTCGAACCGACGCAAAGAACTTCAACGCAATG
CCTCCGCTGGTCACCTCTGGATTACCGTAGTACACACCAATCTTGTATCTAATTTGGTTTAGGAAAATAAGTGTGCAACCAGCTTT
AGAGGCGTTTCCTGACATTTTACGAAGAGCTTGACTCATAAGACGAGCTTGTAACCCCATTTGCTGCATCCCAATCTCACCTTCAA
TCTCGGCACGTGGAGTAAGTGCTGAGACAGAATCAACACATATAAGGTCAACTGCACTTGAACGACACATACGGTCTGCAATTTCT
AAAGCCATCTCGCCATTATCTGGCTGACACACTATGAGATTTTCGACATCAACACCTAACGCTTTAGAGTAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_565198 DNA repair protein recA-like 1 [Arabidopsis thaliana]12505e-135
AAA32855 replicase [Arabidopsis thaliana]12505e-135
BAH56931 AT1G79050 [Arabidopsis thaliana]11233e-120
XP_002332188 predicted protein [Populus trichocarpa]10831e-115
XP_002529953 DNA repair protein reca, putative [Ricinus communis]10767e-115

Swiss-Prot top hits (Blast detail)Scoree value
Q39199 DNA repair protein recA homolog 1, chloroplastic12502e-136
P48293 Protein recA7431e-077
Q7V9V8 Protein recA7162e-074
P14582 Protein recA7152e-074
Q3AMM5 Protein recA7152e-074

TrEMBL top hits (Blast detail)Scoree value
C0Z2K2 AT1G79050 protein11232e-120
B9NAB1 Predicted protein (Fragment)10838e-116
B9SVD4 DNA repair protein reca, putative10765e-115
B8AN40 Putative uncharacterized protein10595e-113
B9F9W5 Putative uncharacterized protein10595e-113

Arabidopsis top hits (Blast detail)Scoree value
AT1G79050.1 DNA repair protein recA12502e-137
AT1G79050.2 DNA repair protein recA7771e-082
AT1G79040.1 PSBR (photosystem II subunit R)6712e-070
AT2G19490.1 recA family protein4742e-047
AT3G32920.1 ATP binding / DNA binding / DNA-dependent ATPase/ nucleoside-triphosphatase/ nucleotide binding3253e-030

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
75  36%
 
104  29%
 
192  14%
 
151  7%
 
91  7%
 
61  7%

Unigene MembersMember information