Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16334

FASTA Sequence
Unigene ID: UN16334Length: 1076 SSRSNP
AAGATCAGAATTTCTTTTTCAGGGGAATGTCTCTGATTCGTATTACAAATAGAGTCTGCATTAGGCAAAGCAGAGGAACAAACACA
TACACACGATGTTTCACACAAGTAGTAGTAGTAGTAGTACATTCACAAAAGAGAAGTAAACTAAGAGTAACTCAATCAGCTTCTGG
ACTTGAATGGGATGGCTCTGATGACAATCACGTGGTAAAGAGCAGCAAGTGCAGCACCGATGAATGGTCCAACCCAAAACACCCAA
TGGTCGTCCCAAGCGTTGTCCTTGTTGAAGATGATTGCAGCTCCAAGACTCCTTGCTGGGTTGATTCCAGTACCAGTGATGGGGAT
GGTTGCTAAGTGGACCAAGAACACAGCGAATCCGATAGGAAGAGGTGCAAGAATGGGAACATGAGAGTCACGAGCGTTCCTCTTGG
CGTCAGTGGCGGAGAAGACGGTGTAAACAAGGACAAAAGTTCCAATAATCTCAGCTCCGAGACCACTTCCTTTAGTGTAACCAGGA
GCTACAGTGTTGGCTCCACCTCCTAGAGCTTGGTACTGCTTTGGTTGGAATCCCTTGACCACACCAGCTCCACAGATGGCTCCTAA
GCACTGCATCACTATGTAGTATACAGCTCGTGTGAGCGAAAGCTTTCTGGCCAAGAACAGACCGAACGTGACAGCTGGGTTGATGT
GTCCACCGGAGATACCAGCGGTGCAGTAGACGAGAGCGAAGATCATACCACCGAAAGCCCAAGCGATCCCTTGGATTCCGACAGAA
GCACACATGTTCGGTGACCTCTTGACTCCCATGACGGTCAAAACAGTGATGTAAAGGAACAAGAACGTGGCGATGAACTCAGCGAT
CCCGGCTCTCCAGAAGGACCACGAAGCAAGCTCGCCGGGCTCGAACAAGGGCGCAGGAGGTGGCTCCTTGTAGTCCTTGTCGCTCT
GAGCCGATGTTCCGATCGGTTGTCTCTCCGGAAACTTGTTGGCTCCGACTCTAACATCTTCTTCCTTGCCTTCCATCTCCAGACGT
CTCTTTTCTCTCTCTAGATGAGTGTGTAATAATAATGTGGTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAA92258 plasma membrane aquaporin 1b [Raphanus sativus]15003e-164
CAA64896 transmembrane channel protein [Brassica oleracea]14977e-164
ACA50530 putative aquaporin [Brassica napus]14977e-164
AAB61378 aquaporin [Brassica rapa subsp. campestris]14951e-163
AAG23179 aquaporin PIP1b1 [Brassica oleracea]14914e-163

Swiss-Prot top hits (Blast detail)Scoree value
Q06611 Aquaporin PIP1-214902e-164
P61837 Aquaporin PIP1-114695e-162
P61838 Aquaporin PIP1.114695e-162
Q08733 Aquaporin PIP1-314283e-157
Q39196 Probable aquaporin PIP1-414141e-155

TrEMBL top hits (Blast detail)Scoree value
Q9MBA0 Plasma membrane aquaporin 1b15002e-164
A9X4U3 Aquaporin PIP114975e-164
B1PRK2 Putative aquaporin14975e-164
Q39384 Transmembrane channel protein14975e-164
Q7GCI6 Plasma membrane aquaporin 1c14975e-164

Arabidopsis top hits (Blast detail)Scoree value
AT2G45960.1 PIP1B (NAMED PLASMA MEMBRANE INTRINSIC PROTEIN 1B); water channel14911e-165
AT3G61430.1 PIP1A (PLASMA MEMBRANE INTRINSIC PROTEIN 1A); water channel14704e-163
AT3G61430.2 PIP1A (PLASMA MEMBRANE INTRINSIC PROTEIN 1A); water channel14704e-163
AT1G01620.1 PIP1C (PLASMA MEMBRANE INTRINSIC PROTEIN 1C); water channel14292e-158
AT4G00430.1 PIP1;4 (PLASMA MEMBRANE INTRINSIC PROTEIN 1;4); water channel14159e-157

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
63  21%
 
94  29%
 
121  7%
 
103  21%
 
191  7%
 
82  14%

Unigene MembersMember information