Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16382

FASTA Sequence
Unigene ID: UN16382Length: 819 SSR 
GCCCAAATAGTGTGCATTATTATTAAGTCGAGAAGCAAGAGTATGCAACGATACATTGAGCAAGAAACAAATACCAAATCATACGA
AACCAAAAACACACAAACTTTCGGTGCTCCGTTTTATTTTCAAGGGTTTATTGGGAAGCAACAGAAAACTAGCGATTCATAAACTT
GATCATCGATCCAGCCATAGTCACTGAAACAAACAAACAAACAAACAATACCAATCTTCGTTCTATAAAGATTGACACCAAAAGCA
AGAGAAGATAGCTTGTACCTTATCGAATTAAGTGGATGGTGCAAGAAGTGGGCGAATCAAGTTAGGAACATGAGCCTGGTGATCCT
CAAGACGACCCTTAACACTGTCTCCATCCCAGCGAACAAGTGTTGGCACTCCGGTGACCTTGAATCGAGGATCGACTCTCCACGGA
TGCATCGGATTCCTCCACGTCGGTCTATCTCCGGCGTAAGCCCGAATAAGATTCACTTCCTCCGGTGATTCCTCTAGAGTCTTGTA
AATCACAGGCTCAGCCCTAACGCAATCTGATTGTAATCATGATAAAAAAAAAGATGATGAGAATTAGATGAAATTGAAAAAAACAA
TGAAAGCCCTAACGGGCCAGGACACCAGCTGCGGTTGGTGCTGGGATCATTGTTGGCGAGGAAGAGGATGAAATTGATCTTGTTAC
GGTTTGATTCGTCAGATTTCAATTCTTCCAACACCGTCTCCAAGGTTGAGGGATCTGCGTCCAGCTTCTTGAGAGTCATTTCTTTT
TTTCTCTACAATACTCAAGATTTCGGTTTCTTTACCAATTTCGTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002863728 hypothetical protein ARALYDRAFT_917431 [Arabidopsis lyrata subsp. lyrata]4331e-040
AAM64350 unknown [Arabidopsis thaliana]4232e-039
NP_568614 thioredoxin-like protein Clot [Arabidopsis thaliana]4178e-039
ACU13745 unknown [Glycine max]3551e-031
XP_002513195 electron transporter, putative [Ricinus communis]3228e-028

Swiss-Prot top hits (Blast detail)Scoree value
Q9FMN4 Thioredoxin-like protein Clot4174e-040
Q5Z9Z3 Thioredoxin-like protein Clot2401e-019

TrEMBL top hits (Blast detail)Scoree value
C6SWX2 Putative uncharacterized protein3558e-032
B9RHH6 Electron transporter, putative3226e-028
A9PBT3 Predicted protein3136e-027
A9NLL0 Putative uncharacterized protein2966e-025
C0PSG7 Putative uncharacterized protein2957e-025

Arabidopsis top hits (Blast detail)Scoree value
AT5G42850.1 INVOLVED IN: cell redox homeostasis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336), Protein of unknown function DUF953, thioredoxin-like (InterPro:IPR010357); Has 237 Blast hits to 237 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 174; Fungi - 29; Plants - 21; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).4182e-041
AT5G42850.2 INVOLVED IN: cell redox homeostasis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336), Protein of unknown function DUF953, thioredoxin-like (InterPro:IPR010357); Has 237 Blast hits to 237 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 174; Fungi - 29; Plants - 21; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).4182e-041

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
82  67%
 
71  33%

Unigene MembersMember information