 |
Information for unigene UN16384
| FASTA Sequence |
| Unigene ID: UN16384 | Length: 640 |
| SNP | GAGAAATTAAACAAAACGAAAAAAAAATAGAGAGGTATTACCAGTGAAGCGAGATGGGCTGCATCGGTCTTATCGATTCAGCCAGT
ATCAATATTTACCGGCCGGTGCTTACAAGAACATCAAACAAACCCTACACGAGAAGAGGACTATCGATGGCTGCGATTCGAGCTGA
GTCAATGGCTACTGAAAAATTAGGGATCTTTATCGAGAAGAATCCTCCCGAGTCCAAACTCACCCAACTAGGTGTTCGTAGTTGGC
CCAAGTGGGGTTGTCCTCCAAGCAAGTTTCCATGGACTTACGATGCAAAGGAGACTTGTTTTCTGCTAGAAGGGAAAGTGAAAGTT
TACCCTAATGGATCCGATGAAGGCGTGGAGATCGAAGCAGGAGACTTTGTTGTTTTCCCTAAAGGAATGAGTTGCACTTGGGACGT
CTCTGTTGCAGTTGATAAGCACTACCAATTCGAGTGAATGGCTATTTACTTCTGCTCCTCATATTGGTGATATGTTTGATATATCT
TCACTGTCTTTGTATGTTGTGGATACTTAATTTTGTGTCATGTATCAGTATCACTCTATGCATTGCTGGGATTTGTTTGCTCCGAT
ATCTAAGTAATTTTTGCGTTATTTAAGACTTTTTAAGG
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| AAM62609 unknown [Arabidopsis thaliana] | 613 | 9e-062 |
| XP_002872504 hypothetical protein ARALYDRAFT_489873 [Arabidopsis lyrata subsp. lyrata] | 605 | 7e-061 |
| NP_192768 cupin domain-containing protein [Arabidopsis thaliana] | 576 | 2e-057 |
| ACU16562 unknown [Glycine max] | 490 | 2e-047 |
| ACU14390 unknown [Glycine max] | 482 | 1e-046 |
| Swiss-Prot top hits | Score | e value |
|---|
| No hits found | | |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| Q8LEK1 Putative uncharacterized protein | 613 | 6e-062 |
| Q9SV91 At4g10300 | 576 | 1e-057 |
| C6T4F2 Putative uncharacterized protein | 490 | 1e-047 |
| C6SYR7 Putative uncharacterized protein | 482 | 9e-047 |
| B9S1T1 Putative uncharacterized protein | 456 | 1e-043 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT4G10300.1 FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04300.1); Has 356 Blast hits to 356 proteins in 93 species: Archae - 0; Bacteria - 181; Metazoa - 0; Fungi - 0; Plants - 80; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). | 597 | 3e-062 |
| AT3G04300.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10300.1); Has 364 Blast hits to 364 proteins in 91 species: Archae - 0; Bacteria - 191; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). | 314 | 2e-029 |
| AT4G10280.1 FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10290.1); Has 293 Blast hits to 293 proteins in 74 species: Archae - 0; Bacteria - 124; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). | 235 | 3e-020 |
| AT4G28703.1 FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04300.1); Has 311 Blast hits to 311 proteins in 80 species: Archae - 0; Bacteria - 147; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink). | 181 | 5e-014 |
| AT4G10290.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10280.1); Has 242 Blast hits to 242 proteins in 52 species: Archae - 0; Bacteria - 84; Metazoa - 0; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). | 181 | 5e-014 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|
