 |
Information for unigene UN16422
FASTA Sequence |
Unigene ID: UN16422 | Length: 1053 |
| SNP | GACAATCATCACAACATTTGACTAGAGCGTAATTCATTGCCTAGAAACAGCTTTATGTTCCCTTGCACATATCATAAACAACTCCA
TCCAATGCAGAAGAAAAAGGGAAAGAAGAAAGCATTCGCTAAAACAAAATGAAGCTTGACTTATTGAAATTGAAATGGGAGAGAGG
GCATATCATTTGATTGTTGTTCCCTTTAGCAGGTACAAAATTATTCAGACGGGTCTTGGAGCTGGGCAGTAGACAGATCATTGATG
TGCGGATACACTGCTTTCTCATCCAGCTGGTTCTGAGCCCAAACCAGCATCTTCAACAAGCTTGGAAGTTTGGGATCTTTTTCATG
ACTCTGGCTTGTAAGAATTGCTGCGTTCACTTCACTTGCAGTCTTAAGACGGTGGGAGATGTCGAGAAGATCTTTAACAGGACAGT
TAGAGGCATCTTCAAAAACAAGCAGCGCTACAGTTTTTTCCAGTTCTTGCAGAAACGCTTGGTTTTCCTCGCCACGTGGAGCAAGT
TCCTCCTGAGCAAACTCCAAGGCTTCTTCGGTCTTGCCTTGTCGAATAAGTTCAATCAACCTTTGCTGCTGAAGATGAAAGAAGAG
CTCGGGGTTTGTGTCTAGTATCTCAGGATTCAAGTCATTAACTTTTTCAATAGCATCCTCGACATTGCCGTTTTGAACAGCCTTTT
TAACAGCCATTCGATCAGTGATGGTTGCAAGATCTATCTCTGGTTTGGTGCCAGACTCCCTTTGGAACTTGTCAGCAGCTTCAACA
TAACCCTCAGTGACAAGGAAGTTCATGACGAGAGTGTTCATGTCTTCTTTCCTAAGCTTTACAGCGTTTAGCTTCTTCTCCCACTC
TTCACGCGTTATCACTTTCTTCGATGTCGCCATATCGTCGTCGTCCTGGAGAAAAAAAGACGATCTCTCTGAGAGAGAGAATCTGG
CGAAACAAAGACGGTGATTCTTTCTGGAGAACTTGATTGCTTCTAGATTTCCTGCGAAACTTGATTGCTTCCCCCGCCCCCCCTAA
TTATTCTACAATCTCGTCCTC
|
|
|
GenBank top hits (Blast detail) | Score | e value |
NP_176310 LisH and RanBPM domain-containing protein [Arabidopsis thaliana] | 1115 | 1e-119 |
XP_002888105 hypothetical protein ARALYDRAFT_475208 [Arabidopsis lyrata subsp. lyrata] | 1100 | 7e-118 |
NP_974061 LisH and RanBPM domain-containing protein [Arabidopsis thaliana] | 1093 | 5e-117 |
AAB71479 Unknown protein [Arabidopsis thaliana] | 1090 | 1e-116 |
NP_001077751 LisH and RanBPM domain-containing protein [Arabidopsis thaliana] | 1065 | 9e-114 |
Swiss-Prot top hits (Blast detail) | Score | e value |
Q54X16 UPF0559 protein | 713 | 2e-074 |
Q5ZKQ7 Protein C20orf11 homolog | 590 | 4e-060 |
Q32L52 Protein C20orf11 homolog | 588 | 8e-060 |
Q9D7M1 Protein C20orf11 homolog | 584 | 2e-059 |
Q9NWU2 Protein C20orf11 | 582 | 4e-059 |
TrEMBL top hits (Blast detail) | Score | e value |
Q84WK5 At1g61150 | 1115 | 9e-120 |
A8MQF1 AT1G61150 protein | 1093 | 3e-117 |
O22730 F11P17.12 protein | 1090 | 7e-117 |
A8MQN5 Uncharacterized protein At1g61150.5 | 1065 | 6e-114 |
B9S5Y6 Protein C20orf11, putative | 1017 | 2e-108 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT1G61150.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). | 1116 | 4e-122 |
AT1G61150.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09300.1); Has 726 Blast hits to 694 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). | 1094 | 1e-119 |
AT1G61150.4 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09300.1); Has 726 Blast hits to 694 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). | 1094 | 1e-119 |
AT1G61150.6 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09300.1); Has 726 Blast hits to 694 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). | 1094 | 1e-119 |
AT1G61150.5 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09300.1); Has 726 Blast hits to 694 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). | 1066 | 3e-116 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|