Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16422

FASTA Sequence
Unigene ID: UN16422Length: 1053  SNP
GACAATCATCACAACATTTGACTAGAGCGTAATTCATTGCCTAGAAACAGCTTTATGTTCCCTTGCACATATCATAAACAACTCCA
TCCAATGCAGAAGAAAAAGGGAAAGAAGAAAGCATTCGCTAAAACAAAATGAAGCTTGACTTATTGAAATTGAAATGGGAGAGAGG
GCATATCATTTGATTGTTGTTCCCTTTAGCAGGTACAAAATTATTCAGACGGGTCTTGGAGCTGGGCAGTAGACAGATCATTGATG
TGCGGATACACTGCTTTCTCATCCAGCTGGTTCTGAGCCCAAACCAGCATCTTCAACAAGCTTGGAAGTTTGGGATCTTTTTCATG
ACTCTGGCTTGTAAGAATTGCTGCGTTCACTTCACTTGCAGTCTTAAGACGGTGGGAGATGTCGAGAAGATCTTTAACAGGACAGT
TAGAGGCATCTTCAAAAACAAGCAGCGCTACAGTTTTTTCCAGTTCTTGCAGAAACGCTTGGTTTTCCTCGCCACGTGGAGCAAGT
TCCTCCTGAGCAAACTCCAAGGCTTCTTCGGTCTTGCCTTGTCGAATAAGTTCAATCAACCTTTGCTGCTGAAGATGAAAGAAGAG
CTCGGGGTTTGTGTCTAGTATCTCAGGATTCAAGTCATTAACTTTTTCAATAGCATCCTCGACATTGCCGTTTTGAACAGCCTTTT
TAACAGCCATTCGATCAGTGATGGTTGCAAGATCTATCTCTGGTTTGGTGCCAGACTCCCTTTGGAACTTGTCAGCAGCTTCAACA
TAACCCTCAGTGACAAGGAAGTTCATGACGAGAGTGTTCATGTCTTCTTTCCTAAGCTTTACAGCGTTTAGCTTCTTCTCCCACTC
TTCACGCGTTATCACTTTCTTCGATGTCGCCATATCGTCGTCGTCCTGGAGAAAAAAAGACGATCTCTCTGAGAGAGAGAATCTGG
CGAAACAAAGACGGTGATTCTTTCTGGAGAACTTGATTGCTTCTAGATTTCCTGCGAAACTTGATTGCTTCCCCCGCCCCCCCTAA
TTATTCTACAATCTCGTCCTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_176310 LisH and RanBPM domain-containing protein [Arabidopsis thaliana]11151e-119
XP_002888105 hypothetical protein ARALYDRAFT_475208 [Arabidopsis lyrata subsp. lyrata]11007e-118
NP_974061 LisH and RanBPM domain-containing protein [Arabidopsis thaliana]10935e-117
AAB71479 Unknown protein [Arabidopsis thaliana]10901e-116
NP_001077751 LisH and RanBPM domain-containing protein [Arabidopsis thaliana]10659e-114

Swiss-Prot top hits (Blast detail)Scoree value
Q54X16 UPF0559 protein7132e-074
Q5ZKQ7 Protein C20orf11 homolog5904e-060
Q32L52 Protein C20orf11 homolog5888e-060
Q9D7M1 Protein C20orf11 homolog5842e-059
Q9NWU2 Protein C20orf115824e-059

TrEMBL top hits (Blast detail)Scoree value
Q84WK5 At1g6115011159e-120
A8MQF1 AT1G61150 protein10933e-117
O22730 F11P17.12 protein10907e-117
A8MQN5 Uncharacterized protein At1g61150.510656e-114
B9S5Y6 Protein C20orf11, putative10172e-108

Arabidopsis top hits (Blast detail)Scoree value
AT1G61150.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).11164e-122
AT1G61150.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09300.1); Has 726 Blast hits to 694 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).10941e-119
AT1G61150.4 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09300.1); Has 726 Blast hits to 694 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).10941e-119
AT1G61150.6 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09300.1); Has 726 Blast hits to 694 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).10941e-119
AT1G61150.5 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09300.1); Has 726 Blast hits to 694 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).10663e-116

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
96  60%
 
61  10%
 
103  30%

Unigene MembersMember information