Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16478

FASTA Sequence
Unigene ID: UN16478Length: 1852  SNP
CAGAAAAACAAAAAAAAAAGAAAGACAAAGAAAAACTAAACAAATTTTCTTTTCTTTTTTTTTCCACTAAAGTTTACATTTTGTCT
ATCGTGTTTGTTTTTTTTAAATGGGAGCTTTCGAAACAGAAAAAACCGCTAAAGATGCGGGGGCTCTAGAGACACAGTCTACAGAG
GAAGAATATAACCAGCCATCTCCTCTCCGTAAAATAATCTCCGTCTCTTCCATCGCCGCCGGTGTTCAGTTCGGGTGGGCCCTACA
GCTCTCTCTCCTCACACCTTACGTCCAGCTTCTTGGTATCCCTCACAAATGGTCCTCTCTCATCTGGCTATGTGGTCCCGTCTCCG
GCATGATCGTCCAACCCATCGTCGGCTTCCACAGCGACAGATGCACGTCAAGATTCGGTCGCCGCCGTCCTTTCATCGCCGCCGGA
GCCGCCATGGTGGCCGTCGCCGTGTTCTTGATCGGGTACGCGGCCGATATCGGGTATAAAATGGGAGACAAACTCGAGCAAACGCC
GAGGGTTCGAGCCATAGGGATCTTTGCTCTCGGGTTCTGGATCCTCGACGTGGCCAACAACACCCTCCAAGGACCTTGCCGTGCTT
TCTTGGCCGACCTAGCCGCAGGAGACGCTAAAAGAACGCGGGTCGCGAACGCGTTTTTCTCTTTCTTTATGGCGGTTGGAAACGTT
TTGGGATACGCGGCTGGTTCTTTCACTAACCTACATAAAATGTTCCCTTTCGCAATGACCAATGCATGCGATATTTACTGCGCTAA
TCTCAAGAGCTGCTTCTTCTTGTCCATCACGCTCCTCCTCCTCGTCACCATCACGTCTCTTTGGTACGTACAAGACAAACAATGGT
CTCCCCCGCCTGTAGCCGCCGGAGAGGAGACTAAGAGTGTTCCTTTCTTTGGAGAAATCTTTGGTGCTTTTAGAGTCATGGAACGT
CCCATGTGGATGCTTCTTATCGTCACGGCGCTAAACTGGATCGCATGGTTCCCGTTTCTTTTGTTCGATACTGATTGGATGGGTCG
TGAAGTGTACGGTGGAGACTCGGAAGGAAACGATAGGTTGAAGCAAATATACAACAAGGGAGTGCAGTCTGGTGCATTGGGGCTTA
TGTTTAACTCTATCGTTCTTGGTTTCATGTCACTTGGTGTTGAGTGGATTGGTAAGAAAGTGGGTGGAGCTAAACGGCTTTGGGGT
ATTGTTAATTTCATTCTTGCCGTTGGTTTAGCCATGACGGTTCTCGTCACGAAATTGGCGGCGGATTACCGGAAAGTTGCGGGTCC
TTATGCCGGACCGTCGCCTGGTATTAGAGCTGGAGCTTTAAGTCTCTTTGCTGTTCTTGGTATCCCATTAGCTATTACTTTCAGTA
TTCCGTTTGCACTAGCATCCATATTTTCAAGCAGCTCCGGCGCCGGCCAAGGACTGTCGTTAGGAGTTTTGAATTTGGCAATTGTG
ATACCCCAAATGATAGTATCACTAGGAGGAGGACCTTTCGACGCCCTTTTCGGCGGTGGAAACTTACCGGCGTTTATAGTCGGAGC
AATCGCAGCGGCGGTCAGTGGAGTGTTAGCTATAACTGTTTTACCTTCACCACCACCGGACGCACCTAGCTTGAAGACAGGAGCCA
TGGGATTCCATTAGTTTATATTATGTTTTATTTTCTTTATGAAACTCGTGATCAAATACAGTACTATTGCGCAAAACTGCAAGACC
CAAAAGCAAAAAATAGAAAAGAACAGAAGATGATAAAGTCTAATAAGCTTGGGTTGTCTGTATTTCACCTTTTCTTTTAGTTTCTT
GTTTTTGTTACCGATATCAAATTGAACAAGATTTTCTTTTTTTTGA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAL58071 sucrose transporter SUC1 [Brassica oleracea]25813e-289
XP_002887396 sucrose-proton symporter 1 [Arabidopsis lyrata subsp. lyrata]23232e-259
NP_177333 sucrose transport protein SUC1 [Arabidopsis thaliana]23116e-258
NP_177334 sucrose transport protein SUC5 [Arabidopsis thaliana]21271e-236
XP_002887397 hypothetical protein ARALYDRAFT_476315 [Arabidopsis lyrata subsp. lyrata]21225e-236

Swiss-Prot top hits (Blast detail)Scoree value
Q39232 Sucrose transport protein SUC123113e-259
Q9C8X2 Sucrose transport protein SUC521276e-238
Q39231 Sucrose transport protein SUC220433e-228
Q9ZVK6 Sucrose transport protein SUC819913e-222
Q6A329 Putative sucrose transport protein SUC619904e-222

TrEMBL top hits (Blast detail)Scoree value
Q8VYX4 Sucrose transporter SUC125812e-289
Q8VYX3 Sucrose transporter SUC220508e-228
B2D1N4 Sucrose transporter20491e-227
Q058N2 At1g6657019656e-218
A5BFD8 Putative uncharacterized protein17542e-193

Arabidopsis top hits (Blast detail)Scoree value
AT1G71880.1 SUC1 (Sucrose-proton symporter 1); carbohydrate transmembrane transporter/ sucrose:hydrogen symporter/ sugar:hydrogen symporter23122e-260
AT1G71890.1 SUC5; carbohydrate transmembrane transporter/ sucrose:hydrogen symporter/ sugar:hydrogen symporter21356e-240
AT1G22710.1 SUC2 (SUCROSE-PROTON SYMPORTER 2); carbohydrate transmembrane transporter/ sucrose transmembrane transporter/ sucrose:hydrogen symporter/ sugar:hydrogen symporter20442e-229
AT2G14670.1 ATSUC8 (Sucrose-proton symporter 8); carbohydrate transmembrane transporter/ sucrose:hydrogen symporter/ sugar:hydrogen symporter19913e-223
AT5G43610.1 ATSUC6 (Sucrose-proton symporter 6); carbohydrate transmembrane transporter/ sucrose:hydrogen symporter/ sugar:hydrogen symporter19904e-223

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
203  11%
 
72  7%
 
85  19%
 
103  11%
 
122  7%
 
68  30%
 
114  15%

Unigene MembersMember information