Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16535

FASTA Sequence
Unigene ID: UN16535Length: 839 SSRSNP
GCATTGGATACAGTTTGAATCGGGTATATGCCTTATGGATTCTTCTTCTTCTTCTCCTTCTCTCTCTACCTAAAGCTAAAGCTATC
GCGCGATTGATCCATCCACCATCGGCGCTATGGAGGATTCTACGGCTACAACGACTCATCATTATTTCACCATTTTCACGAATTAC
CCTCTCATCTCCTCCCTCACGGCTTTCACCATCGCTCAATTCATCAAACTCTTCACCTCCTGGTATAGGGAAAGGAGATGGGATCT
GAAACAGCTTATTGGGTCCGGAGGAATGCCTTCTTCTCACTCAGCTACCGTTACTGCTCTCGCTGTTGCTATCGGTTTGCAAGAGG
GCTTTGGTGGTTCTCATTTCGCTATTGCTCTCATCTTAGCTTCTGTTGTGATGTATGATGCTACTGGTGTGAGGTTACACGCGGGT
CGCCAGGCTGAGGTTCTCAATCAGATTGTCTACGAACTTCCTGCAGAACATCCTCTGGCTGAAAGCAGACCATTGCGTGAACTTCT
CGGCCATACCCCTCCCCAGGTAGTTGCTGGCGGAATGCTTGGAAGTGTCACAGCAGTCACTGGATATTTATTTACCAGGGTTGCTA
CTAGCTAACGTGTGAACGAACAATCATAGACCACAACTCGCCTGCTTCATTCCCTAGTGCAACCGCTGGACAGTGGACAGAACCGA
AAGCAGATTTACAATCAAAGCCTTAGTTTAATTCACTCTATATATAATCGTATTCATGAATATTCTATTTGAAATGTAAAGAAAAC
TTGAACACCATTACAACAAATAAAAAACGTAATTTTATTTGGAAAATAATACAAAGAATTTGTCG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_564215 Acid phosphatase/vanadium-dependent haloperoxidase-related protein [Arabidopsis thaliana]7824e-081
AAM63820 unknown [Arabidopsis thaliana]7762e-080
XP_002890712 hypothetical protein ARALYDRAFT_890238 [Arabidopsis lyrata subsp. lyrata]7709e-080
NP_176927 Acid phosphatase/vanadium-dependent haloperoxidase-related protein [Arabidopsis thaliana]7062e-072
XP_002888611 hypothetical protein ARALYDRAFT_315776 [Arabidopsis lyrata subsp. lyrata]7001e-071

Swiss-Prot top hits (Blast detail)Scoree value
O32107 Uncharacterized membrane protein yuiD2472e-020

TrEMBL top hits (Blast detail)Scoree value
B9DG97 AT1G24350 protein7823e-081
Q8LC64 Putative uncharacterized protein7761e-080
Q9FXC5 At1g676007062e-072
Q9FYM6 F21J9.16838e-070
Q8GYY2 At1g243506802e-069

Arabidopsis top hits (Blast detail)Scoree value
AT1G24350.1 INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 626 Blast hits to 626 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).7831e-083
AT1G67600.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24350.1); Has 627 Blast hits to 627 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).7061e-074
AT1G24350.2 INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 622 Blast hits to 622 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).6801e-071
AT3G21610.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 626 Blast hits to 626 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).5052e-051
AT3G21610.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 610 Blast hits to 610 proteins in 200 species: Archae - 0; Bacteria - 358; Metazoa - 0; Fungi - 0; Plants - 102; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).4291e-042

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
116  50%
 
102  17%
 
91  8%
 
62  17%
 
191  8%

Unigene MembersMember information