Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16666

FASTA Sequence
Unigene ID: UN16666Length: 946  SNP
GGAACTCACACTCTCTCTTCAATCCTTCTAGTTAAGAAAGACTTGGATCAGAAATGGCCACCTCAGCAATCCAGCAATCCTCCTTC
GCTGGCCAAACGGCCCTAAAGCCCTCCAACGATCTCCTCCGCAAGGTCGGTGTCTCCGGCGGCGGCCGCGTGACCATGCGCCGCAC
AGTCAAGTCTACTCCTCAAAGCATTTGGTACGGACCAGACCGTCCAAAGTACTTGGGACCGTTCTCCGAGAACACACCGTCCTACC
TAACCGGAGAATACCCCGGAGACTACGGCTGGGACACCGCGGGACTTTCCGCTGACCCAGAGACATTCGCTAAGAACCGTGAGCTC
GAAGTAATCCACAGCAGATGGGCAATGCTGGGAGCTCTAGGCTGCACGTTCCCCGAGATCCTCTCCAAGAACGGAGTCAAATTCGG
AGAAGCCGTGTGGTTCAAGGCAGGATCCCAGATCTTCTCAGAAGGAGGTCTTGACTACCTCGGAAACCCTAACTTGATCCACGCGC
AAAGCATCTTAGCCATCTGGGCTTGTCAAGTTGTGCTCATGGGTTTGATCGAAGGGTACAGAATCGGAGGTGGTCCTCTCGGAGAA
GGTCTTGACCCGCTTTACCCCGGAGGTGCGTTCGACCCGTTGAATTTGGCAGAGGACCCGGAGGCCTTCGCTGAGCTGAAGGTGAA
GGAGCTCAAGAACGGACGTCTTGCCATGTTCTCCATGTTTGGATTCTTTGTTCAAGCAATTGTTACTGGTAAAGGTCCCATCGAGA
ACTTGTTTGATCACTTGGCAGATCCTGTGGCTAACAACGCCTGGTCTTTCGCTACCAACTTTGTCCCCGGAAAGTGATTTATCTAT
CTTATGGATTTGCTTCACCGTCTTATCTTACTTTGTAAAAGCATCAATGTATTGGTCGTGTTTTATGTGAATTTGGTACTTGGGGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAD28771 Lhcb2 protein [Arabidopsis thaliana]13856e-151
XP_002885789 Lhcb2 protein [Arabidopsis lyrata subsp. lyrata]13856e-151
AAD28769 Lhcb2 protein [Arabidopsis thaliana]13812e-150
NP_178585 photosystem II light harvesting complex protein 2.1 [Arabidopsis thaliana]13802e-150
NP_178582 photosystem II light harvesting complex protein 2.2 [Arabidopsis thaliana]13722e-149

Swiss-Prot top hits (Blast detail)Scoree value
P27518 Chlorophyll a-b binding protein 151, chloroplastic13002e-142
P27494 Chlorophyll a-b binding protein 36, chloroplastic12832e-140
P12062 Chlorophyll a-b binding protein 37, chloroplastic12832e-140
P12328 Chlorophyll a-b binding protein of LHCII type I, chloroplastic12519e-137
P14278 Chlorophyll a-b binding protein 4, chloroplastic12501e-136

TrEMBL top hits (Blast detail)Scoree value
Q9XF86 Lhcb2 protein13854e-151
Q9SYW9 Lhcb2 protein13811e-150
Q9SHR7 At2g05100/F15L11.213801e-150
Q9S7J7 At2g05070/F1O13.2013721e-149
Q9XF87 At3g2770013612e-148

Arabidopsis top hits (Blast detail)Scoree value
AT2G05100.1 LHCB2.1; chlorophyll binding13816e-153
AT2G05070.1 LHCB2.2; chlorophyll binding13735e-152
AT3G27690.1 LHCB2.3; chlorophyll binding13621e-150
AT2G34420.1 LHB1B2; chlorophyll binding10752e-117
AT1G29910.1 CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding10691e-116

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
72  12%
 
82  12%
 
197  41%
 
62  12%
 
103  18%
 
111  6%

Unigene MembersMember information