Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16720

FASTA Sequence
Unigene ID: UN16720Length: 1528  SNP
GGGGTTAAGTATGATGGATCGAGAAGAAGGCGCCGTGAAGGAAGAAGAAGATAAGCTCTCTGGTTACGCCACGCTTCCCAATACAT
ATAACCATCTCTGACGTCATCTTCTATCTTTATCCAATATATAAAACCTGTCGTGCCGATTCCTCTTCTGGAGACAATCAAATAAT
CAAACCTCTAATCGAACGCAAAAAAAAGAAGAAGCAGAGCTATGGATGCAAACCAACGAATCGCAAGAATCTCTGCTCATCTCAAC
CCTCCTAATCTCGATAAGAATGGTTCCGGGTCGGATCTGAGACGGGTGGGTTGTCGGGCAAAAGGCGGGTCTCCCGGATTCAAAGT
GGCGATACTTGGAGCAGCGGGAGGGATAGGACAGCCACTAGCGATGTTGATGAAGATGAATCCTCTGGTCTCGCTTCTCCATCTCT
ACGACGTTGCTAACGCTCCTGGTGTCACCGCTGATATTAGTCACATGGACACTAGTGCCATCGTTCGTGGATTTCTCGGGCAACCG
CAGTTAGAGGAGGCACTCACGGGTATGGATCTAGTGATTATACCAGCTGGAGTTCCGAGGAAGCCAGGGATGACGAGGGATGATCT
TTTCAACATCAACGCCGGCATCGTCAGGACGCTCTCCGAAGCTATAGCCAAGTGCTGTCCCAAAGCGATTGTGAATATCATCAGTA
ATCCGGTGAACTCCACGGTGCCGATCGCAGCGGAGGTTTTCAAGAAAGCTGGTACTTTTGATCCGAAGAAACTCATGGGAGTCACC
ATGCTTGATGTTGTTAGAGCTAATACTTTTGTGGCGGAAGTAATGAGTCTTGATCCTCGAGAAGTTGATGTTCCGGTTGTTGGAGG
ACACGCAGGAGTTACAATCTTGCCTCTGCTTTCTCAGGTGAAACCTCCTTGCTCTTTCACTCAGAAAGAGATTGAATATCTCACAG
ACCGCATCCAAAATGGTGGCACTGAAGTTGTCGAGGCAAAAGCTGGTGCAGGTTCTGCAACATTATCAATGGCTTACGCAGCAGTG
AAGTTTGCAGATGCTTGTCTCAGGGGTCTACGAGGCGATGCAAACATTGTCGAGTGTGCATTTGTGGCCTCTCATGTGACTGAGCT
TCCCTTCTTCGCATCAAAGGTGCGTCTAGGAAGATGTGGGGTCGATGAAGTGTACGGTCTCGGACCATTGAACGAATACGAGAGGA
TGGGATTAGAGAAGGCAAAGAAAGAGCTTGGAGGGAGTATTGCGAAAGGTGTTACCTTTGTCAAGAAGTAGTAAAGAGAATTGATA
AAAACACTTTTAGTTTTATCTTTTGGAATAGTGATTTGTTTGGAATAAGAACAATGCCTCGCAATGAAAGCTCCTGCGAGTAGAGT
CTGATGTTGAAGATTTAATAAACTGCAATCACTTTGTTCTTAGATACGGGAACGTTTATGAGTTGATATTCTTATCTTCTTGGTAT
GTTTCCTTAGTTTTATGTGCGTTTTTCTTCTGCTTAGTATTATTGCGCCTAAGATCAACTCCACAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880457 peroxisomal NAD-malate dehydrogenase 1 [Arabidopsis lyrata subsp. lyrata]17093e-188
NP_179863 malate dehydrogenase [Arabidopsis thaliana]16923e-186
XP_002522037 malate dehydrogenase, putative [Ricinus communis]15581e-170
XP_002310874 predicted protein [Populus trichocarpa]15491e-169
XP_002270921 PREDICTED: hypothetical protein [Vitis vinifera]15472e-169

Swiss-Prot top hits (Blast detail)Scoree value
O82399 Probable malate dehydrogenase, glyoxysomal16921e-187
P19446 Malate dehydrogenase, glyoxysomal15461e-170
P46488 Malate dehydrogenase, glyoxysomal15423e-170
Q9ZP05 Malate dehydrogenase, glyoxysomal14912e-164
Q9XFW3 Malate dehydrogenase 2, glyoxysomal14653e-161

TrEMBL top hits (Blast detail)Scoree value
Q0WUS4 Malate dehydrogenase16922e-186
B9S7S1 Malate dehydrogenase15587e-171
B9HFT0 Malate dehydrogenase15497e-170
A5BEJ8 Malate dehydrogenase15471e-169
A9PGE6 Malate dehydrogenase15157e-166

Arabidopsis top hits (Blast detail)Scoree value
AT2G22780.1 PMDH1 (PEROXISOMAL NAD-MALATE DEHYDROGENASE 1); L-malate dehydrogenase/ binding / catalytic/ malate dehydrogenase/ oxidoreductase/ oxidoreductase, acting on the CH-OH group of donors, NAD or NADP as acceptor16938e-189
AT5G09660.1 PMDH2 (peroxisomal NAD-malate dehydrogenase 2); malate dehydrogenase14922e-165
AT5G09660.2 PMDH2 (peroxisomal NAD-malate dehydrogenase 2); malate dehydrogenase14331e-158
AT5G09660.4 PMDH2 (peroxisomal NAD-malate dehydrogenase 2); malate dehydrogenase12815e-141
AT5G09660.3 PMDH2 (peroxisomal NAD-malate dehydrogenase 2); malate dehydrogenase12223e-134

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
124  15%
 
212  8%
 
117  27%
 
64  15%
 
182  8%
 
104  15%
 
73  12%

Unigene MembersMember information