Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16776

FASTA Sequence
Unigene ID: UN16776Length: 1333  SNP
CCCATCAAACAACACTTTTCAACAAATCTGTAATTATAAATAATACTGACTTCATGACAATGCAACTACAAAGAGCCAAATCTTAA
GTTTCACAAACAATATAGAAACTAACAAAAACACACATATAAATAATAACGCTCTCTGTCTCTCTGAGTTTTAAAATGCATGAGAA
CAACACAAAGACAACATCCAAGAAGCTCCAAAATGATCTCCTTTTGCATGCACCACTCATTTCTGAAACCGTTCCGATAAGGAAAA
GAGAGATCTCATGATTTGGTTTTTAACGGTATGATTCAGGACGTTTAGGTTTGCTCTGTATCACTTGCTCGATCTTGTCTAGAACA
TGTGGCGTCAACAATGGGATCACATCAACAGCCTTCATGTTTTCTTGAATCTGTGACTCCCTTGTGGCACCAGTGATAACAGAAGA
CACATTAGGATTTGAAGCACACCACGCGATTGCAAGCTGAGCCAATGTTACACCTAGCTCATCTGCAATAGGCTTGAGACCACTAA
CTTTCCTCAGAACATCATCCACAAGTGATCTATTGGCAAGGTTTTTGTAGTTCTCCAATGCAAATCGGCTGTCCGAAGGAATAGCT
CCCTTGTTGTATTTACCAGTGAGCACACCAGATGCAAGTGGACTCCAAGTAGTGAGACCTATGCCATGGTTTGTGTACAGAGGAAG
AAACTCTGACTCAACCTTGTGCCTAGCGAACATGTTGTACTCAGGCTGTTCAACGATTGGACCGACCAGATCCAACCTCTCAGCAG
CTCCCCATGCCTCTGTGATCTGTTGAGCCGACCATTCACTAGTTCCCCAGTAGAAAGCCCAACCCTTATCAATCACGTAGTTCATC
GCCCTCACCGTCTCTTCTATAGGTGTTGAAGCATCAGGCCTGTGACAATAGAGCACATCGACATAGTCCATATCGAGTCTTTTGAG
AGAAGCTTTGGTTCCTTCAACTATATGTTTCCTGGACAAACCTTTGTCGTTAGGACCAGGACCACCCCAGAAGATCTTGGTGGAGA
CAACGACGTCGGATCTGCGCCAACCGAGCTCGCGAATCGCCTGGCCCATGATCTCCTCGGCGCGACCATTGGCGTAAACCTCGGCG
TTGTCGAAGAAATTGACCCCGTGATCGCGACAGCACTGGAGAATCGATTTGGCTTCTTTCACATCTAGCTGGTTGCCGAAAGTGAC
CCACGCTCCGAAAGAGAGCGTGCTCACCTTCAATCCCGATCTCCCCAAGTTCTTGTACTGCATCTTTTTTTTGCCGAAAGATCGAG
ACGAATCTGTTTTGATCTGAAGAGTTGAAATGAGAGAGATCCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002889520 hypothetical protein ARALYDRAFT_470455 [Arabidopsis lyrata subsp. lyrata]17031e-187
NP_171963 potassium channel beta subunit 1 [Arabidopsis thaliana]17022e-187
AAA87294 K+ channel protein [Arabidopsis thaliana]16771e-184
XP_002518142 potassium channel beta, putative [Ricinus communis]15911e-174
XP_002299286 predicted protein [Populus trichocarpa]15874e-174

Swiss-Prot top hits (Blast detail)Scoree value
Q40648 Probable voltage-gated potassium channel subunit beta15144e-167
Q4PJK1 Voltage-gated potassium channel subunit beta-18721e-092
P63143 Voltage-gated potassium channel subunit beta-18721e-092
P63144 Voltage-gated potassium channel subunit beta-18721e-092
Q27955 Voltage-gated potassium channel subunit beta-28712e-092

TrEMBL top hits (Blast detail)Scoree value
O23016 Potassium channel beta subunit homolog17021e-187
Q39151 K+ channel protein16779e-185
B9RWM3 Potassium channel beta, putative15918e-175
B9GMG6 Predicted protein15872e-174
A9PDE6 Putative uncharacterized protein15845e-174

Arabidopsis top hits (Blast detail)Scoree value
AT1G04690.1 KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); oxidoreductase/ potassium channel17035e-190
AT1G60710.1 ATB2; oxidoreductase2536e-022
AT1G60750.1 oxidoreductase2412e-020
AT5G53580.1 aldo/keto reductase family protein2331e-019
AT1G10810.1 aldo/keto reductase family protein2161e-017

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
103  25%
 
203  25%
 
61  8%
 
181  8%
 
92  17%
 
191  8%
 
121  8%

Unigene MembersMember information