Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN16780

FASTA Sequence
Unigene ID: UN16780Length: 693 SSR 
AGTAGAAAAAAATACATAAATGAATCAAGTTCATCCTCATTTATGCCAGTTTTGGTTGTAACACATGAAACTTTATTTACTTTACA
CAAACACAAGTGAAAGACATGGTTTGTTTTTTGTTCATCTCACCCACGCAAATGTAGCCCCCATCTCATATATATTTAACACATCC
TCTCTTGTAAAAATACAAAAGAAATTAAACCCGAAAAGTGTATAAACTAGTACCATTTTCTTGAGACAATTACTAATATACGTAGA
ATGAGATATGTAAAGATCTCTCTCTCTTTATGGATATGGTAAAAGGGAACTTTTTAGTCTGTCTTCATGTTGTTGTTGTTGTTTTC
TTTTAAATCCCAATTCAAGGGTTTTGCTCATCAAAAATGTCCAAAAGAGAAAGAACCTCAGGGACGGTGAGTTCGAGGCGGAACTT
AGGGCCGTCGTAGTGATGGAGAATAGGACGGAAAGAATCTTATTCCAAAGGCAAACAAACTTTCCTGGTGATGGCCCTGACCTGAG
CAGGGAACCGAGATTCGCCAGGACATTTCTTGTCTTCGAAAGCGTTGAGCTCAATGTTAGTCCCACCGAAGCTAGCGGCCTGGTAA
ACACCGTGGAGCTGGTGAGTGGAGTAGTTGTAGAAGAAGAGAGGAAGACCGGGAGTGATGGCTCTAAACGAGTCCCTGTATCTCGG
AGGCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAB08438 unnamed protein product [Arabidopsis thaliana]5521e-054
NP_568600 DCD (Development and Cell Death) domain protein [Arabidopsis thaliana]5521e-054
XP_002870594 hypothetical protein ARALYDRAFT_493778 [Arabidopsis lyrata subsp. lyrata]5521e-054
XP_002518847 n-rich protein, putative [Ricinus communis]5233e-051
XP_002297967 predicted protein [Populus trichocarpa]5091e-049

Swiss-Prot top hits (Blast detail)Scoree value
P37707 B2 protein4746e-047

TrEMBL top hits (Blast detail)Scoree value
Q8RXN8 Putative uncharacterized protein5529e-055
Q9FHX9 Genomic DNA, chromosome 5, P1 clone:MJC205529e-055
B9RYM8 N-rich protein, putative5232e-051
B9GL33 Predicted protein5098e-050
A9PHN9 Putative uncharacterized protein5009e-049

Arabidopsis top hits (Blast detail)Scoree value
AT5G42050.1 FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G27090.1); Has 5084 Blast hits to 2870 proteins in 85 species: Archae - 0; Bacteria - 24; Metazoa - 270; Fungi - 58; Plants - 157; Viruses - 8; Other Eukaryotes - 4567 (source: NCBI BLink).5534e-057
AT3G27090.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42050.1); Has 642 Blast hits to 564 proteins in 35 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 0; Plants - 155; Viruses - 0; Other Eukaryotes - 473 (source: NCBI BLink).4461e-044
AT3G11000.1 LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G01660.1); Has 173 Blast hits to 164 proteins in 29 species: Archae - 0; Bacteria - 6; Metazoa - 2; Fungi - 4; Plants - 153; Viruses - 1; Other Eukaryotes - 7 (source: NCBI BLink).1484e-010
AT3G11000.2 EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G01660.1).1484e-010
AT2G35140.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11000.2); Has 160 Blast hits to 150 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 154; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).1342e-008

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
82  100%

Unigene MembersMember information